artificial nucleic acid molecules

专利摘要:
The present invention relates to artificial nucleic acid molecules comprising new combinations of elements from the 5 'and 3' untranslated region (RTU). The nucleic acid molecules of the invention are preferably characterized by increased expression efficacies of coding regions operably linked to said elements of the RTU. Artificial nucleic acids can be used for the treatment or prophylaxis of various diseases. The invention further provides (pharmaceutical) compositions, vaccines and kits comprising said artificial nucleic acid molecules. In addition, in vitro methods for the preparation of artificial nucleic acid molecules according to the invention are provided.
公开号:BR112020004351A2
申请号:R112020004351-6
申请日:2018-10-17
公开日:2020-09-08
发明作者:Thomas Schlake；Andreas Thess；Moritz Thran；Frédéric Chevessier-Tünnesen；Marion PÖNISCH
申请人:Curevac Ag；
IPC主号:

专利说明:

[0001] [0001] To date, therapeutic nucleic acids in the form of naked DNA, viral or bacterial DNA vectors are explored for a variety of purposes. Gene therapy seeks to treat diseases by transferring one or more therapeutic nucleic acids to a patient's cells (gene addition therapy) or correcting a defective gene (gene replacement therapy), for example, by editing genes . This technology transfer promises to provide long-lasting therapies for diseases that are not curable - or only temporarily - with conventional treatment options, and even to provide treatments for diseases previously classified as intractable. Gene therapy strategies currently available are typically based on releasing genes in vivo to post-mitotic target cells or tissues or releasing genes ex vivo in autologous cells followed by adoptive transfer back to the patient (Kumar et al. Mol Ther Methods Clin Dev. 2016; 3: 16034). For some time, clinical gene therapy has been characterized by some encouraging results, but also by several setbacks. The preferred method of gene release, in terms of defined composition and manufacturing reproducibility, would involve bare DNA supplied in a suitable vehicle, such as synthetic particles, for example, using lipids or polymers. However, these methods have not yet achieved efficient uptake and sustained gene expression in vivo. Thus, trials of gene replacement therapy that have demonstrated some clinical benefit, were based on viral vectors for the release of genes. Among the various virus-based vector systems, adeno-associated virus (AAV) DNA vectors are most commonly used for the in vivo release of genes. The use of retroviral vectors (derived from y-retroviral or slow
[0002] [0002] Immunotherapy is the second important field of application for therapeutic nucleic acids. In particular, DNA vaccines that encode tumor antigens have been evaluated for immunotherapy against cancer. In principle, taking advantage of the patient's own adaptive immunity to fight cancer cells seems attractive. DNA-based vaccines based on non-viral DNA vectors can generally be easily designed and produced quickly in large quantities. These DNA vectors are stable and can be easily stored and transported. Unlike attenuated bacterial or viral vaccines, there is no risk of pathogenic infection or induction of an antiviral immune response. Naked DNA does not spread easily from cell to cell in vivo. APCs do not readily absorb expressed antigens and activate satisfactory immune responses (Yang et al. Hum Vaccin Immunother. 2014 Nov; 10 (11): 3153-3164). On the other hand, the limited uptake and consequent limited transcription of antigens by the transfected cells is the main disadvantage of non-viral vaccines based on
[0003] [0003] Administration by electroporation or virus-mediated release solves the issue, but opens up new problems. In the case of electroporation, the availability of clinically approved devices and patient compliance limited their use in the clinic. In the case of virus-mediated release, the problems are mainly related to the potential dangers associated with the administration of live viruses, together with the presence of neutralizing antiviral antibodies in patients (Lollini et al. Vaccines. 2015 Jun; 3 (2 ): 467-489).
[0004] [0004] Since its initial development, vaccine and gene therapy technologies based on nucleic acids have come a long way. Unfortunately, when applied to human subjects, inadequate uptake and transcription has only achieved limited clinical success due to insufficient expression of genes or antigens. The inadequate release of therapeutic proteins (in the case of gene therapy) or immunogenicity (in the case of immunotherapy) are still the greatest challenge for the practical use of therapeutic DNA. Li and Petro- vsky Expert Rev Vaccines. 2016; 15 (3): 313-329. Although RNA-based therapy overcomes many of the shortcomings of therapeutic DNA, there is still room for improvement in terms of the expression efficiencies currently observed for the available therapeutic RNAs. Thus, urgent effective strategies that help to increase the therapeutic potency of nucleic acids are urgently needed. It is an objective of the present invention to comply with the
[0005] [0005] Although the present invention is described in detail below, it should be understood that this invention is not limited to the particular methodologies, protocols and reagents described herein, as these may vary. It should also be understood that the terminology used herein is not intended to limit the scope of the present invention, which will be limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used in this invention have the same meanings as are commonly understood by a person of practical skill in the art.
[0006] [0006] In the following, the elements of the present invention will be described. These elements are listed with specific modalities, however, it must be understood that they can be combined in any way and in any number to create additional modalities. The examples described in different ways and preferred modalities should not be interpreted to limit the present invention to only the modalities explicitly described. This description must be understood to support and cover the modalities that combine the modalities explicitly described with any number of the disclosed and / or preferred elements. In addition, any permutations and combinations of all elements described in this application should be considered disclosed by the description of this application, unless the context indicates otherwise.
[0007] [0007] Throughout this specification and the claims that follow, unless the context otherwise requires, the term "to understand" and variations such as "comprises" and "comprising" will be understood to imply the inclusion of a member , whole number or stage, but not the exclusion of any other undeclared member, whole number or stage. The term "consist of" is a particular form of the term "understand", in which any other member,
[0008] [0008] The terms "one" and "one" and "o" "a" and similar reference used in the context of describing the invention (especially in the context of the claims) should be interpreted to cover both the singular and the plural, unless otherwise indicated in this invention or clearly contradicted by the context. The recitation of ranges of values in this invention is only intended to serve as an abbreviated method of referring individually to each separate value within the range. Unless otherwise indicated in this invention, each individual value is incorporated into the specification as if it were recited here individually. No language in the specification should be interpreted as indicating any unclaimed elements essential to the practice of the invention.
[0009] [0009] The word "substantially" does not exclude "completely", for example, a composition that is "substantially free" from Y may be completely free from Y. Where necessary, the word "substantially" may be omitted from the definition of the invention.
[0010] [0010] The term "about" in relation to a numerical value x means x + 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10% .
[0011] [0011] In the present invention, if not indicated otherwise, different characteristics of alternatives and modalities can be combined with each other.
[0012] [0012] In consideration of clarity and legibility, the following definitions are provided. Any technical characteristic mentioned for these definitions can be read in any and all types of information.
[0013] [0013] Artificial nucleic acid molecule: An artificial nucleic acid molecule can typically be understood as a nucleic acid molecule, for example, a DNA or RNA, which does not occur naturally. In other words, an artificial nucleic acid molecule can be understood as a non-natural nucleic acid molecule. This nucleic acid molecule may be unnatural due to its individual sequence (which does not occur naturally) and / or due to other modifications, for example, structural modifications of nucleotides, which are not naturally occurring. An artificial nucleic acid molecule can be a DNA molecule, an RNA molecule or a hybrid molecule comprising parts of DNA and RNA. Typically, artificial nucleic acid molecules can be designed and / or generated by genetic engineering methods to correspond to a desired artificial nucleotide sequence (heterologous sequence). In this context, an artificial sequence is generally a sequence that may not be naturally occurring, that is, it differs from the wild type sequence by at least one nucleotide. The term "wild type" can be understood as a sequence that occurs in nature. In addition, the term "artificial nucleic acid molecule" is not restricted to the meaning of "a single molecule", but is typically understood to comprise a set of identical molecules. Consequently, it may be related to a plurality of identical molecules contained in an aliquot.
[0014] [0014] DNA: DNA is the usual abbreviation for deoxyribonucleic acid. It is a nucleic acid molecule, that is, a polymer that consists of nucleotides. These nucleotides are generally deoxy-adenosine-monophosphate monoxides, deoxy-thymidine-monophosphate, deoxy-
[0015] [0015] Heterologous sequence: Two sequences are typically understood as 'heterologous' if they are not derivable from the same gene. That is, although the heterologous sequences can be derived from the same organism, they naturally (in nature) do not occur in the same nucleic acid molecule, as in the same mRNA.
[0016] [0016] Cloning site: A cloning site is typically understood as a segment of a nucleic acid molecule, which is suitable for insertion of a nucleic acid sequence, for example, a nucleic acid sequence comprising a open reading structure. Insertion can be carried out by any molecular biological method known to a person skilled in the art, for example, through restriction and bonding. A cloning site typically comprises one or more restriction enzyme recognition sites (restriction sites). These one or more restriction sites can be recognized by restriction enzymes that cleave DNA at those sites. A cloning site that comprises more than one restriction site can also be called a multiple site.
[0017] [0017] Nucleic acid molecule: A nucleic acid molecule is a molecule that preferably comprises nucleic acid. The term nucleic acid molecule preferably refers to molecules of DNA or RNA. A synonym with the term "polynucleotide" is preferably used. Preferably, a nucleic acid molecule is a polymer that comprises or consists of nucleotide monomers, which are covalently linked together by phosphodiester bonds of a sugar / phosphate backbone. The term "nucleic acid molecule" also encompasses modified nucleic acid molecules, such as base-modified DNA or RNA molecules, modified with sugar or modified with the main chain, etc.
[0018] [0018] Open reading frame: An open reading frame (ORF) in the context of the invention can typically be a sequence of several nucleotide triplets, which can be translated into a peptide or protein. An open reading frame preferably contains a start codon, that is, a combination of three subsequent nucleotides that generally encode the amino acid methionine (ATG), at its 5 'end and in the subsequent region, which generally presents a length that is a multiple of 3 nucleotides. An ORF is preferably terminated by a stop codon (for example, TAA, TAG, TGA). This is typically the only stop codon in the open reading frame. Thus, an open reading frame in the context of the present invention is preferably a nucleotide sequence, which consists of several nucleotides that can be divided by three, starting with a start codon (for example, ATG) and which preferably ends with a stop codon (for example, TAA, TGA or TAG). The open reading frame can be isolated or can be incorporated into a longer nucleic acid sequence, for example, a vector or an mRNA. An open reading frame can also be called a "coding sequence (protein)" or, preferably, a "coding sequence".
[0019] [0019] Peptide: A peptide or polypeptide is typically a polymer of amino acid monomers, linked by peptide bonds. Typically contains less than 50 monomer units. However, the term peptide is not a negation for molecules with more than 50 monomer units. Long peptides are also called polypeptides, typically having between 50 and 600 monomeric units.
[0020] [0020] Protein: A protein typically comprises one or more peptides or polypeptides. A protein is typically folded into three-dimensional shape, which may be necessary for the protein to exercise its biological function.
[0021] [0021] Restriction site: A restriction site, also called the restriction enzyme recognition site, is a nucleotide sequence recognized by a restriction enzyme. A restriction site is typically a short nucleotide sequence of palindromic preference, for example, a sequence comprising 4 to 8 nucleotides. A restriction site is preferably specifically recognized by a restriction enzyme. The restriction enzyme typically cleaves a nucleotide sequence comprising a restriction site at this location. In a double-stranded nucleotide sequence, such as a double-stranded DNA sequence, the restriction enzyme typically cuts both strands of the nucleotide sequence.
[0022] [0022] RNA, mRNA: RNA is the usual abbreviation for ribonucleic acid. It is a nucleic acid molecule, that is, a polymer that consists of nucleotides. These nucleotides are generally adenosine monophosphate, uridine monophosphate, guanosine monomers
[0023] [0023] Sequence of a nucleic acid molecule: The sequence of a nucleic acid molecule is typically understood to be the particular and individual order, that is, the succession of its nucleotides. The sequence of a protein or peptide is typically understood to be the order, that is, the succession of its amino acids.
[0024] [0024] Sequence identity: Two or more sequences are identical if they have the same nucleus length and order
[0025] [0025] Stabilized nucleic acid molecule: A stabilized nucleic acid molecule is a nucleic acid molecule, preferably a DNA or RNA molecule that is modified in such a way that it is more stable to disintegration or degradation, for example, through environmental factors or enzymatic digestion, such as by a degradation of exo- or endonuclease, than the nucleic acid molecule without modification. Preferably, a nucleic acid molecule stabilized in the context of the present invention is stabilized in a cell, such as a prokaryotic or eukaryotic cell, preferably in a mammalian cell, such as a human cell. The stabilizing effect can also be exerted outside the cells, for example, in a buffer solution etc., for example, in a process for making a pharmaceutical composition comprising the stabilized nucleic acid molecule.
[0026] [0026] Transfection: The term "transfection" refers to the introduction of nucleic acid molecules, such as DNA or RNA molecules (for example, mRNA), into cells, preferably eukaryotic cells. In the context of the present invention, the term "transfection" encompasses any method known to the person skilled in the introduction of nucleic acid molecules into cells, preferably in eukaryotic cells, such as in mammalian cells. Such methods include, for example, electroporation, lipofection, for example, based on cationic lipids and / or liposomes, calcium phosphate precipitation, nanoparticle-based transfection, virus-based transfection or transfection based on cationic polymers, such as DEAE-dextran or polyethyleneimine, etc. Preferably, the introduction is not viral.
[0027] [0027] Vector: The term "vector" refers to a nucleic acid molecule, preferably an artificial nucleic acid molecule. A vector in the context of the present invention is suitable for incorporating
[0028] [0028] Vehicle: A vehicle is typically understood to be a material suitable for storing, transporting and / or managing a
[0029] [0029] In nature, precise control of gene expression is vital to adjust quickly to environmental stimuli that alter the physiological status of the cell, such as cell stress or infection. Gene expression programs are constantly regulated and are strongly regulated by multi-layer regulatory elements that act in cis and trans. For such a precise control, the cell machinery has developed regulators in various stages of transcription until the translation of the fine-tuned gene expression. This includes structural and chemical modifications of chromosomal DNA, transcriptional regulation, post-transcriptional control of messenger RNA (mMRNA), which varies the efficiency of translation and protein turnover. These mechanisms together determine the spatio-temporal control of the genes. The messenger RNA is composed of a protein coding region and 5 'and 3 untranslated regions (RTUs). The 3 'RTU is variable in sequence and size; it extends between the stop codon and the poly (A) tail. It is important to note that the 3 'RTU sequence contains several regulatory motives that determine the turnover, stability and location of the mMRNA and, therefore, governs many aspects of post-transcriptional gene regulation (Schwerk and Savan. J Immunol. 2015 Oct 1 ; 195 (7): 2963-2971). In gene therapy and immunotherapy applications, strict regulation of transgene expression is of paramount importance for therapeutic safety and efficacy. Transgenes need to be expressed at ideal thresholds in the right places. However, the ability to control the level of expression of the transgene, in order to provide a balance between therapeutic efficacy and nonspecific toxicity, remains a major challenge in current applications of gene therapy and immunotherapy. The present inventors surprisingly found that certain combinations of 5 'and 3' untranslated regions (RTUs) work together to synergistically improve the expression of operably linked nucleic acid sequences. The artificial nucleic acid molecules that house the inventive RTU combinations advantageously allow the rapid and transient expression of large amounts of (polypeptides or proteins released for the purposes of gene therapy or immunotherapy. In addition, the new therapy The nucleic acid base disclosed in this invention preferably offers additional advantages over the treatment options currently available, including the reduced risk of insertion mutagenesis and greater efficiency of non-viral release and absorption. artificial supplements provided herein are particularly useful for various in vivo therapeutic applications, including, for example, gene therapy, cancer immunotherapy or vaccination against infectious agents.
[0030] Consequently, in a first aspect, the present invention thus relates to an artificial nucleic acid molecule comprising at least one element of the 5 '(5' UTR) untranslated region derived from a 5 'UTR of a selected gene the group consisting of HSD17B4, ASAH1, ATP5SA1, MP68, NDUFA4, NO-SIP, RPL31, SLC7A3, TUBB4B and UBQLN32; at least one element of the 3 '(3' RTU) untranslated region derived from a 3 'RTU of a gene selected from the group consisting of PSMB3, CASP1, COX6B1, GNAS, NDUFA1 and RPS9; and optionally at least one coding region operably linked to said 3 'UTR and said 5' UTR.
[0031] [0031] The term "RTU" refers to an "untranslated region" located upstream (5 ') and / or downstream (3') of a coding region
[0032] [0032] When referring to an RTU element "derived from the" RTU of a given gene, the RTU element can be derived from any homologous, variant or naturally occurring fragment of said gene. That is, when referring to an RTU element "derived from" an HSD17BA gene, the respective RTU element may consist of a nucleic acid sequence that corresponds to a shorter UTR sequence of the "source" HSD17B4 gene. or in any HSD17B4 homologue, variant or fragment (in particular, including HSD17BA homologues, variants or fragments, including variations in the UTR region compared to the "source" HSD17B4 gene).
[0033] [0033] The term "derived from" as used throughout this specification in the context of an artificial nucleic acid, that is, for an artificial nucleic acid "derived from" (other) artificial nucleic acid, also means that the nucleic acid (artificial), which is derived from (other) artificial nucleic acid, shares, for example, at least 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86% , 87%, 88%, 89%, 90%, 91%, 92%, 93%, 294%, 95%, 96%, 97%, 98% or 99% of sequence identity with the nucleic acid of which it is derivative. The knowledgeable person is aware that the sequence identity is typically calculated for the same types of nucleic acids, that is, for DNA sequences or for RNA sequences. Thus, it is understood, if a DNA is "derived" from an RNA or if an RNA is "de-
[0034] [0034] The term "homologous" in the context of genes (or nucleic acid sequences derived or comprised by said gene, such as a RTU) refers to a gene (or nucleic acid sequences derived therefrom by said gene) related to a second gene (or such a nucleic acid sequence) through the progeny of a common ancestral DNA sequence. The term "homologous" includes genes separated by the speciation event ("ortholog") and genes separated by the genetic duplication event ("para-log").
[0035] [0035] The term "variant" in the context of gene nucleic acid sequences refers to variants of nucleic acid sequences
[0036] [0036] Furthermore, the term "variant" as used throughout this specification in the context of proteins or peptides, will be recognized and understood by the person of practical skill in the art, and is, for example, intended to refer to a protein or peptide variant that has an amino acid sequence that differs from the original sequence in one or more mutations, such as one or more substituted, inserted and / or excluded amino acids. Preferably, these fragments and / or variants have the same biological function.
[0037] [0037] The term "fragment" in the context of nucleic acid sequences or genes refers to a continuous substring of the complete reference (or "source") nucleic acid sequence or gene. In other words, a "fragment" can typically be a shorter part of a nucleic acid sequence or whole gene. Consequently, a fragment typically consists of a sequence that is identical to the corresponding stretch within the nucleic acid sequence or complete gene. The term includes naturally occurring fragments, as well as manipulated fragments. A preferred fragment of a sequence in the context of the present invention consists of a continuous stretch of nucleic acids that corresponds to a continuous stretch of entities in the nucleic acid or gene from which the fragment is derived, which represents at least 20% , preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70% and most preferably at least 80% of the total (i.e., total length) of the nucleic acid sequence or gene from which the fragment is derived. A sequence identity indicated with respect to a fragment preferably refers to the entire nucleic acid sequence or gene. Preferably, a "fragment" may comprise a nucleic acid sequence having a sequence identity of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% , 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferable
[0038] [0038] The elements of the RTU are preferably "functional", that is, capable of provoking the same desired biological effect as the original RTU from which they derive, that is, in particular to modulate, control or regulate (induce, intensify , reduce, revoke or prevent, preferably induce or intensify) the expression of an operably linked coding sequence. The term "expression", as used herein, generally includes all stages of protein biosynthesis, inter alia, transcription, mRNA processing and translation. The elements of the RTU, in particular the elements of the 3'-RTU and SUTR in the combinations specified here, may, for example (usually through the action of the regulatory regions comprised by the referred RTU elements) regulate polyadenylation, the start of translation, translation efficiency, nucleic acid location and / or stability comprising said RTU elements.
[0039] [0039] Artificial nucleic acid molecules of the invention advantageously comprise at least one element of the 5 'UTR and at least one element of the 3' UTR, each derived from a gene selected from the groups disclosed herein. Suitable 5 'RTU elements are preferably selected from 5-RTU elements derived from a 5' RTU of a gene selected from the group consisting of HSD17B4, ASAH1, ATPSA1, MP68, NDUFA4, NOSIP, RPL31, SLC7A3 , TUBB4B and UBQLN , preferably as defined herein. Suitable 3 'RTU elements are preferably selected from 3' RTU elements derived from a 3 'RTU of a gene selected from the group consisting of PSMB3, CASP1, COX6B1, GNAS, NDUFA1 and RPS9, preferably as defined herein. . In addition, the artificial nucleic acid molecules of the invention may optionally comprise at least one coding region operably linked to said 3 'RTU element and said 5' RTU element. Preferably, the artificial nucleic acid molecules of the invention can therefore comprise, in a 5'-3 'direction, an element of the 5-UTR as defined herein, operably linked to a coding region (cds) encoding a (poly) peptide or protein of interest and an element of the 3 'UTR, connected in an operable way to the said coding region: 5-UTR - cds - 3 UTR.
[0040] [0040] Typically, the 5'- and / or 3-UTR elements of the artificial nucleic acid molecules of the invention can be "heterologous" to at least one coding sequence. The term "heterologous" is used in this invention to refer to a nucleic acid sequence that is typically derived from a species other than a reference nucleic acid sequence. A "heterologous sequence" can therefore be derived from a gene which is of a different origin compared to a reference sequence and can typically differ, in its nucleic acid sequence, from the reference sequence and / or can encode a different genetic product. RTU 5 'RTU
[0041] [0041] The artificial nucleic acid described herein comprises at least one element of the 5'-UTR derived from a 5 'UTR of a gene as indicated herein, or a homolog, variant, fragment or derivative thereof.
[0042] [0042] The term "5-UTR" refers to a part of a nucleic acid molecule, located 5 '(i.e., "upstream") of an open reading frame and which is not translated into protein. In the context of the present invention, a 5'-RTU begins with the initial transcription site
[0043] [0043] Preferably, the at least one element of the 5 'UTR comprises or consists of a nucleic acid sequence derived from the 5' UTR of a stranded gene, preferably a vertebrate gene, more preferably a mammalian gene, more preferably a mammalian gene, most preferably a human gene or a 3 'UTR variant of a chord gene, preferably a vertebrate gene, more preferably a mammalian gene, most preferably a human gene.
[0044] [0044] Some of the elements of the 5 'RTU specified in this
[0045] [0045] A 5 'RTU of a TOP gene does not normally comprise any start codon, preferably no upstream AUGs (uAUGs) or upstream open reading frames (uUORFs). In it, upstream AUGs and upstream open reading frames are typically understood as AUGs and open reading frames occurring 5 'from the start codon (AUG) of the open reading frame that must be translated.
[0046] [0046] In one embodiment, the 5 'end of an mRNA is "gggaga".
[0047] The elements of the 5 'UTR derived from the 5'UTRs of the TOP genes exemplified in this invention may preferably not have a TOP motif or a 5'TOP, as defined above. Thus, the nucleic acid sequence of the 5 'UTR element, which is derived from a 5' UTR of a TOP gene, can end at its 3 'end with a nucleotide located at position 1, 2, 3, 4, 5, 6,7, 8, 90u 10 upstream of the start codon (for example, A (U / T) G) of the gene or MRNA that is derived. Thus, the 5 'UTR element does not comprise any part of the protein coding sequence. Thus, preferably, the only amino acid coding part of artificial nucleic acid is provided by the coding sequence.
[0048] [0048] Particular elements of 5-RTUs provided according to the present invention are described in detail below. HSD17B4-derived 5 'RTU elements
[0049] [0049] The artificial nucleic acids according to the invention may comprise an element of the 5 'UTR derived from a 5' UTR of a gene encoding a 17-beta-hydroxysteroid dehydrogenase 4, or a homolog, variant, fragment or derivative thereof. , preferably without the 5'TOP motif.
[0050] Such elements of the 5 'UTR preferably comprise or consist of a nucleic acid sequence that is derived from the 5' UTR of a 17-beta-hydroxysteroid dehydrogenase 4 gene (also called type 2 peroxisomal multifunctional enzyme), preferably vertebrate, more preferably 17-beta-gene
[0051] Consequently, the artificial nucleic acids according to the invention may comprise a 5'UTR element derived from an HSD17B4 gene, in particular derived from the 5 'UTR of said HSD17BA gene, preferably in which said element of SUTR comprises or consists of a DNA sequence according to SEQ ID NO: 1 or its homologue, variant, fragment or derivative, in particular a DNA sequence having, in increasing order of preference, at least 5% , 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90 % and most preferably at least 95% or even 97%, of sequence identity with a nucleic acid sequence according to SEQ ID NO: 1, or in which said SUTR element comprises or consists of a sequence of RNA according to SE Q ID NO: 2, or its counterpart, variant, fragment or derivative, in particular an RNA sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40% , 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97 %, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, sequence identity with a nucleic acid sequence according to SEQ ID NO: 2. ASAH1 derived 5 'RTU elements
[0052] [0052] Artificial nucleic acids according to the invention may comprise an element of 5'UTR derived from a 5'UTR of a gene encoding ceramidase acid (ASAH1), or its homolog, variant, fragment or derivative.
[0053] Such elements of the 5'UTR preferably comprise or consist of a nucleic acid sequence that is derived from the S'UTR of a ceramidase acid (ASAH1) gene, preferably a vertebrate, more preferably mammalian, most preferable acid gene human ceramidase (ASAH1), or its counterpart, variant, fragment or derivative. Said gene preferably encodes an acid ceramidase protein that corresponds to human ceramidase acid (UniProt Ref. No. Q13510, entry version tH177 of 7 June 2017), or its homolog, variant, fragment or derivative.
[0054] Consequently, the artificial nucleic acids according to the invention may comprise an element of the 5'UTR derived from an ASAH1 gene, in particular derived from the 5 'UTR of said ASAH1 gene, preferably in which said element of SUTR comprises or consists of a DNA sequence in accordance with SEQ ID NO: 3 or its homologue, variant, fragment or derivative, in particular a DNA sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93% , 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and the most preferable of at least 95% or even 97%, of identity of
[0055] [0055] Artificial nucleic acids according to the invention may comprise an element of the 5'UTR that is derived from an S'UTR of a gene encoding the ATP alpha subunit of the mitochondrial synthase (ATPSA1), or its homologue , variant, fragment or derivative, in which said element of the 5 'RTU preferably lacks the 5'TOP motif.
[0056] Such elements of the 5'UTR preferably comprise or consist of a nucleic acid sequence that is derived from the S'UTR of an ATP alpha subunit gene of the mitochondrial synthase (ATP5A1), preferably from a vertebrate, more preferably a mammal and most preferable is a human ATP alpha subunit gene of mitochondrial synthase (ATPSA1), or its homolog, variant, fragment or derivative, wherein the 5'UTR element preferably does not comprise the 5'TOP of said gene. Said gene can preferably encode a protein from the alpha ATP subunit of the mitochondrial synthase that corresponds to the alpha ATP subunit acid from the human mythondrial synthase (UniProt Ref. No. P25705, entry version
[0057] Accordingly, the artificial nucleic acids according to the invention can comprise an element of the 5'UTR derived from an ATP5A1 gene, in particular derived from the 5 'UTR of said ATPB5A1 gene, preferably wherein said element of the SUTR comprises or consists of a DNA sequence according to SEQ ID NO: or its homologue, variant, fragment or derivative, in particular a DNA sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30 %, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at at least 95% or even 97%, of sequence identity to the nucleic acid sequence according to SEQ ID NO: 5, or in which said element of the SUTR comprises or consists of an RNA sequence according to SEQ ID NO: 6, or its counterpart, variant, fragment or derivative, in particular an RNA sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60% , 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 294%, 95%, 96%, 97%, 98% or 99 %, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, identity sequence with the nucleic acid sequence according to SEQ ID NO: 6. MP68 derived 5 'RTU elements
[0058] [0058] Artificial nucleic acids according to the invention may comprise an element of 5'UTR which is derived from a
[0059] Such elements of the 5'UTR preferably comprise or consist of a nucleic acid sequence that is derived from the S'UTR of a 6.8 kDa mitochondrial proteolipid gene (MP68), preferably from a vertebrate, more preferably one mammal and most preferably a 6.8 kDa mitochondrial proteolipid gene (MP68) from human, or its homolog, variant, fragment or derivative. Said gene can preferably encode a 6.8 kDa mitochondrial proteolipid (MP68) protein that corresponds to the 6.8 kDa mitochondrial proteolipid (MP68) (UniProt Ref. No. P56378, entry version% 127 of February 15, 2017), or its counterpart, variant, fragment or derivative.
[0060] Consequently, the artificial nucleic acids according to the invention may comprise a 5'UTR element derived from an MP68 gene, in particular derived from the 5 'UTR of said MP68 gene, preferably where said element of the SUTR comprises or consists of a DNA sequence according to SEQ ID NO: 7 or its homologue, variant, fragment or derivative, in particular a DNA sequence having, in increasing order of preference, at least 5% , 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93 %, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least least 90% and most preferable at least 95% or even 97%, of sequence identity to the nucleic acid sequence according to SEQ ID NO: 7, or in which said SUTR element comprises or consists of a sequence - copy of RNA according to SEQ ID N O: 8, or its counterpart, variant, fragment or derivative, in particular a sequence of RNA ten-
[0061] [0061] Artificial nucleic acids according to the invention may comprise an element of 5'UTR which is derived from an S'UTR of a gene encoding a cytochrome c oxidase subunit (NDUFAJ4), or its homolog, fragment or variant .
[0062] Such elements of the 5'UTR preferably comprise or consist of a nucleic acid sequence that is derived from the S'UTR of a cytochrome c oxidase (NDUFA4) subunit gene, preferably from a vertebrate, more preferably a mammal, the more preferable is a human cytochrome c oxidase (NDUFA4) subunit gene, or its homolog, variant, fragment or derivative. Said gene can preferably encode a cytochrome c oxidase subunit protein (NDUFA4) that corresponds to a human cytochrome c oxidase subunit protein (NDUFA4) (UniProt Ref. No. O00483, entry version ft149 of 30 of August 2017).
[0063] [0063] Consequently, the artificial nucleic acids according to the invention may comprise an element of the 5'UTR derived from an NDUFAA4 gene, wherein said element of the SUTR comprises or consists of a DNA sequence according with SEQ ID NO: 9 or its homolog, variant, fragment or derivative, in particular a DNA sequence having, in ascending order of preference,
[0064] [0064] Artificial nucleic acids according to the invention may comprise an element of the 5UTR that is derived from a 5UTR of a gene that encodes a protein interacting with nitric oxide synthase (NOSIP), or its homolog, variant, fragment or derivative.
[0065] Such elements of the 5'UTR preferably comprise or consist of a nucleic acid sequence that is derived from the S'UTR of a nitric oxide synthase interaction protein (NOSIP) gene, preferably from a vertebrate, more preferably a mammal , the most preferable a gene of the nitric oxide synthase interaction protein (NOSIP), or its homolog, variant, fragment or derivative. Said gene can preferably encode a protein of interest
[0066] Accordingly, the artificial nucleic acids according to the invention can comprise an element of the 5'UTR derived from a NOSIP gene, wherein said element of the SUTR comprises or consists of a DNA sequence according to SEQ ID NO : 11 or its counterpart, variant, fragment or derivative, in particular a DNA sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70 %, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with the nucleic acid sequence according to SEQ ID NO: 11, or in which said element of the SUTR comprises or consists of an RNA sequence according to SEQ ID NO: 12, or its homologue, variant ante, fragment or derivative, in particular u an RNA sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with the nucleic acid sequence according to to SEQ ID NO: 12. Elements of the 5 'RTU derived from RPL31
[0067] [0067] Artificial nucleic acids according to the invention may comprise an element of 5'UTR which is derived from a
[0068] Such elements of the 5'UTR preferably comprise or consist of a nucleic acid sequence that is derived from the S'UTR of a 60S L31 ribosomal protein gene, preferably from a vertebrate, more preferably a mammal, most preferably a human 60S L31 ribosomal protein gene, or its homolog, variant, fragment or derivative, wherein the S'UTR element preferably does not comprise the 5'TOP of said gene. Said gene can preferably encode a 60S L31 ribosomal protein which corresponds to a 60S L31 ribosomal protein from being human (UniProt Ref. No. P62899, entry version 4138 of 30 August 2017).
[0069] Consequently, artificial nucleic acids according to the invention may comprise a 5'UTR element derived from an RPL31 gene, wherein said 5 RTU element comprises or consists of a DNA sequence according to SEQ ID NO: 13 or its homologue, variant, fragment or derivative, in particular a DNA sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97% , of sequence identity with the nucleic acid sequence according to SEQ ID NO: 13, or wherein said element of the SUTR comprises or consists of an RNA sequence according to SEQ ID NO: 14, or its homologous, variant, fragment or derivative, in particular ular an RNA sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87% , 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferable at least 95% or even 97%, of sequence identity with the nucleic acid sequence accordingly. with SEQ ID NO: 14. Elements of the 5 'RTU derived from SLC7A3
[0070] [0070] Artificial nucleic acids according to the invention may comprise an element of the 5'UTR which is derived from a SUTR of a gene encoding a cationic amino acid transporter protein 3 (family of 7-member solute vehicles 3 , SLC7A3), or its counterpart, variant, fragment or derivative.
[0071] Such elements of the 5'UTR preferably comprise or consist of a nucleic acid sequence that is derived from the SUTR of a cationic amino acid carrier gene 3 (SLC7A3), preferably from a vertebrate, more preferably a mammal, most preferably a human cationic amino acid transporter 3 (SLC7A3) gene, or its counterpart, variant, fragment or derivative. Said gene may preferably encode a cationic amino acid transporter protein 3 (SLC7A3) which corresponds to a human cationic amino acid transporter protein 3 (SLC7A3) (UniProt Ref. No. Q8WY07, entry version ft139 of 30 August 2017).
[0072] Consequently, the artificial nucleic acids according to the invention may comprise a 5'UTR element derived from an SLC7A3 gene, wherein said SUTR element comprises or consists of a DNA sequence according with SEQ ID NO: 15 or its counterpart, variant, fragment or derivative, in particular
[0073] [0073] Artificial nucleic acids according to the invention may comprise an element of the 5'UTR that is derived from an S'UTR of a gene encoding a tubulin beta-4B protein (TUBB4B), or its homologue , variant, fragment or derivative.
[0074] Such elements of the 5'UTR preferably comprise or consist of a nucleic acid sequence that is derived from the S'UTR of a tubulin beta-4B gene (TUBB4B), preferably from a vertebrate, more preferably one mammal, most preferably a human tubulin beta-4B chain (TUBB4B) gene, or its homolog, variant, fragment or derivative. Said gene can preferably encode a tubulin beta-4B chain protein (TUBB4B) that corresponds to a human beetle-4B chain protein (TUBB4B) from human (UniProt Ref. No. Q8WY07, entry version 142 of August 30, 2017).
[0075] Accordingly, the artificial nucleic acids according to the invention can comprise a 5'UTR element derived from a tubulin beta-4B chain gene (TUBB4B), wherein said SUTR element comprises or consists of a sequence of DNA according to SEQ ID NO: 17 or its homologue, variant, fragment or derivative, in particular a DNA sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40% , 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97 %, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with the nucleic acid sequence according to SEQ ID NO: 17, or in which said element of the 5 RTU comprises or consists of an RNA sequence according to SEQ ID NO: 18, or its counterpart, variant, fragment or derivative, in particular an RNA sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70 %, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with the nucleic acid sequence according to SEQ ID NO: 18. Elements of the 5 'RTU derived from UBQLN2
[0076] [0076] Artificial nucleic acids according to the invention may comprise an element of the 5'UTR that is derived from a 5'UTR of a gene encoding a ubiquillin-2 protein (UBQLN2), or its homolog, variant, fragment or derivative.
[0077] Such elements of the 5'UTR preferably comprise or consist of a nucleic acid sequence that is derived from the S'UTR of a ubiquillin-2 gene (UBQLN2), preferably from a vertebrate, more preferably a mammal, most preferably a human ubiquillin-2 (UBQLN2) gene, or its counterpart, variant, fragment or derivative. Said gene can preferably encode a ubiquilin-2 protein (UBQLN2) which corresponds to a human ubiquilin-2 protein (UBQLN2) (UniProt Ref. No. Q9UHDS, entry version X151 of 30 August 2017).
[0078] Accordingly, the artificial nucleic acids according to the invention may comprise a 5'UTR element derived from a ubiquilin-2 gene (UBQLN2), wherein said S'UTR element comprises or consists of a sequence of DNA according to SEQ ID NO: 19 or its counterpart, variant, fragment or derivative, in particular a DNA sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30 %, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with the nucleic acid sequence according to SEQ ID NO: 19, or in which said element of the 5 RTU comprises or consists of an RNA sequence according to SEQ ID NO: 20, or its counterpart, variant, fragment or deri in particular an RNA sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85 %, 86%,
[0079] [0079] The artificial nucleic acid described herein further comprises at least one element of the 3'-UTR derived from a 3 'UTR of a gene as defined herein, or a homolog, variant or fragment of said gene. The term "3-UTR" refers to a part of a nucleic acid molecule, which is located 3 '(i.e., "downstream") from an open reading frame and which is not translated into protein. In the context of the present invention, a 3'-RTU corresponds to a sequence that is located between the stop codon of the protein coding sequence, preferably immediately 3 'to the stop codon of the protein coding sequence, and the sequence poly (A) of the artificial nucleic acid (RNA) molecule.
[0080] [0080] Preferably, the at least one element of the 3UTR comprises or consists of a nucleic acid sequence derived from the 3UTR of a stranded gene, preferably a vertebrate gene, more preferably a murine gene, even more preferred - possibly a mammalian gene, most preferably a human gene, or a 3UTR variant of a stranded gene, preferably a vertebrate gene, more preferably a murine gene, even more preferably a mammalian gene, most preferably a human gene. PSMB3-derived 3-RTU elements
[0081] [0081] Artificial nucleic acids according to the invention may comprise an element of 3'UTR which is derived from a
[0082] Such elements of the 3'UTR preferably comprise or consist of a nucleic acid sequence that is derived from the 3'UTR of a type 3 beta proteasome subunit gene (PSMB3), preferably from a vertebrate, more preferably a mammal, the more preferable is a human proteasome beta type 3 (PSMB3) subunit gene, or its homolog, variant, fragment or derivative. Said gene can preferably encode a protein of the proteasome beta type 3 subunit (PSMB3) that corresponds to a protein of the proteasome beta type 3 subunit (PSMB3) of being human (UniProt Ref. No. P49720, entry version ft183 of 30 August 2017).
[0083] Accordingly, the artificial nucleic acids according to the invention may comprise a 3'UTR element derived from a PSMB3 gene, wherein said 3UTR element comprises or consists of a DNA sequence according to SEQ ID NO : 23 or its counterpart, variant, fragment or derivative, in particular a DNA sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70 %, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with the nucleic acid sequence according to SEQ ID NO: 23, or in which said element of 3UTR comprises or consists of an RNA sequence according to SEQ ID NO: 24, or its homologue, variant ante, fragment or derivative, in particular u an RNA sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with the nucleic acid sequence according to to SEQ ID NO: 24. Elements of CASP1-derived 3-RTU
[0084] [0084] Artificial nucleic acids according to the invention may comprise an element of 3'UTR that is derived from a 3'UTR of a gene encoding a Caspase-1 (CASP1) protein, or its homolog, variant, fragment or derivative.
[0085] Such elements of the 3'UTR preferably comprise or consist of a nucleic acid sequence that is derived from the 3'UTR of a Caspase-1 gene (CASP1), preferably from a vertebrate, more preferably a mammal, most preferably a human Caspase-1 (CASP1) gene, or its counterpart, variant, fragment or derivative.
[0086] Consequently, artificial nucleic acids according to the invention may comprise a 3'UTR element derived from a CASP1 gene, wherein said 3UTR element comprises or consists of a DNA sequence according to with SEQ ID NO: 25 or its counterpart, variant, fragment or derivative, in particular a DNA sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% , 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, sequence identity to the nucleic acid sequence according to SEQ ID NO: 25, or in which said element of 3UTR comprises or consists of an RNA sequence according to SEQ ID NO: 26 , or its counterpart, variant, fragment or derivative, in a RNA sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87% , 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferable at least 95% or even 97%, of sequence identity with the nucleic acid sequence accordingly. with SEQ ID NO: 26. Elements of COX6B1-derived 3-RTU
[0087] [0087] Artificial nucleic acids according to the invention may comprise a 3'UTR element that is derived from a 3'UTR of a COX6B1 gene that encodes a protein of the cytochrome c oxidase 6B1 subunit (COX6B1), or its homologous, variant, fragment or derivative.
[0088] Such elements of the 3'UTR preferably comprise or consist of a nucleic acid sequence that is derived from the 3UTR of a cytochrome c oxidase 6B1 subunit gene (COX6B1), preferably from a vertebrate, more preferably a mammal, most preferably A human cytochrome c oxidase 6B1 (COX6B1) subunit gene or its homologue, variant, fragment or derivative is preferable. Said gene can preferably encode a cytochrome c oxidase 6B1 subunit protein (COX6B1) that corresponds to a human cytochrome c oxidase 6B1 (COX6B1) subunit protein (UniProt Ref. No. P14854, entry version tt166 of 30 August 2017).
[0089] [0089] Consequently, the artificial nucleic acids according to the invention may comprise a 3'UTR element derived from a COX6B1 gene, wherein said 3UTR element comprises or consists of a DNA sequence according to with SEQ ID NO: 27 or its counterpart, variant, fragment or derivative, in particular a DNA sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% , 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, sequence identity to the nucleic acid sequence according to SEQ ID NO: 27, or in which said element of 3UTR comprises or consists of an RNA sequence according to SEQ ID NO: 28 , or its counterpart, variant, fragment or derivative, in pa cross-link an RNA sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87% , 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferable at least 95% or even 97%, of sequence identity with the nucleic acid sequence accordingly. with SEQ ID NO: 28. Elements of 3-RTU derived from GNAS
[0090] [0090] Artificial nucleic acids according to the invention may comprise a 3'UTR element derived from a 3'UTR of a gene encoding a short isoform protein of the guanine G (s) binding protein subunit subunit (GNAS), or its counterpart, variant, fragment or derivative.
[0091] Such elements of the 3'UTR preferably comprise or consist of a nucleic acid sequence that is derived from the 3'UTR of a short isoform gene of the guanine G (s) binding protein subunit (GNAS) subunit, preferably from a vertebrate, more preferably a mammal, most preferably a short isoform protein gene from the human guanine G (s) (GNAS) nucleotide-binding subunit, or its homolog, variant, fragment or derivative. Said gene may preferably encode a protein of short isoforms of the guanine nucleotide-binding protein subunit (GNAS) that corresponds to a protein of short isoforms of the guanine-nucleotide binding protein subunit ( s) (GNAS) of human (Uni- Prot Ref. No. P63092, entry version ft153 of 30 August 2017).
[0092] Accordingly, the artificial nucleic acids according to the invention can comprise a 3 'UTR element derived from a GNAS gene, wherein said 3UTR element comprises or consists of a DNA sequence according to SEQ ID NO : 29 or its counterpart, variant, fragment or derivative, in particular a DNA sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70 %, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with the nucleic acid sequence according to SEQ ID NO: 29, or in which said element of 3UTR comprises or consists of an RNA sequence according to SEQ ID NO: 30, or its homologue, variant ante, fragment or derivative, in particular u an RNA sequence having, in ascending order of preference, at least 5%, 10%,
[0093] [0093] Artificial nucleic acids according to the invention may comprise an element of 3'UTR that is derived from a 3'UTR of a gene encoding a protein of the complex alpha subunit 1 of NADH dehydrogenase [ubiquinone] 1 (NDUFA1 ), or its counterpart, variant, fragment or derivative.
[0094] Such elements of the 3'UTR preferably comprise or consist of a nucleic acid sequence that is derived from the 3'UTR of a complex alpha subunit 1 gene of NADH dehydrogenase [ubiquinone] 1 (NDUFA1), preferably of a vertebrate, more preferably a mammal, most preferably a human NADH dehydrogenase [ubiquinone] 1 (NDUFA1) alpha subunit complex 1 gene, or its homologue, variant, fragment or derivative. Said gene may preferably encode a protein of the complex alpha subunit 1 of NADH dehydrogenase [ubiquinone] 1 (NDUFA1) which corresponds to a protein of the complex alpha subunit 1 of NADH dehydrogenase [ubiquinone] 1 (NDUFA1) of being human ( UniProt Ref. No. 015239, entry version% 152 of 30 August 2017).
[0095] Accordingly, the artificial nucleic acids according to the invention can comprise a 3'UTR element derived from an NDUFA1 gene, wherein said 3 UTR element comprises or consists of a DNA sequence according to SEQ ID NO: 31 or its counterpart, variant, fragment or derivative, in particular a DNA sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% , preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with the nucleic acid sequence according to SEQ ID NO: 31, or in which said element of 3UTR comprises or consists of an RNA sequence according to SEQ ID NO: 32, or its homologue, vari - ante, fragment or derivative, in particular an RNA sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with the nucleic acid sequence according to to SEQ ID NO: 32. RPS9-derived 3'-RTUs
[0096] [0096] Artificial nucleic acids according to the invention may comprise a 3'UTR element that comprises or consists of a nucleic acid sequence, which is derived from a 3UTR of a gene encoding a 40S S9 ribosomal protein (RPS9), or its counterpart, variant, fragment or derivative.
[0097] Such elements of the 3'UTR preferably comprise or consist of a nucleic acid sequence that is derived from the 3'UTR of a ribosomal 40S S9 gene (RPS9), preferably from a vertebrate, more preferably a mammal, most preferable is a human ribosomal 40S S9 (RPS9) gene, or its homolog, variant, fragment or derivative. Said gene can preferably encode a 40S S9 ribosomal protein (RPS9) that corresponds to a 40S S9 ribosomal protein (RPS9) (UniProt Ref. No. P46781, entry version% 179 of 30 August 2017).
[0098] Consequently, the artificial nucleic acids according to the invention may comprise an element of 3'UTR derived from an RPS9 gene, wherein said element of 3UTR comprises or consists of a DNA sequence according to SEQ ID NO: 33 or its homologue, variant, fragment or derivative, in particular a DNA sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60 %, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with the nucleic acid sequence according to SEQ ID NO: 33, or wherein said element of the SUTR comprises or consists of an RNA sequence according to SEQ ID NO: 34, or its counterpart , variant, fragment or derivative, in particular an RNA sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87% , 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferable at least 95% or even 97%, of sequence identity with the nucleic acid sequence accordingly. with SEQ ID NO: 34.
[0099] [0099] Preferably, the at least one element of the 5 RTU and the at least one element of the 3 'RTU act synergistically to modulate, more preferably induce or intensify, the expression of at least one coding sequence operably linked to the said elements of the RTU. It is envisaged here to use each element of the 5'- and 3-RTU exemplified here in any conceivable combination.
[00100] [00100] The preferred combinations of the elements of the 5'- and 3-RTU are listed in table 1 below. Table 1: Combinations of RTU element of the 5th RTU element of the 3 'RTU love the lama in the eea) Pod e am Pes e er a) Pd e es po eee Fo e BP eea E am a pq e er a) Er ps and element of the 5th RTU element of the 3 'RTU derived from ame derivative To lama in the derivative of derivative of [9 a and aa
[00101] [00101] Especially the following combinations of RTU are preferred: SUTR: ASAH1 + 3'UTR: CASP1; SUTR: ASAH1 + 3'UTR: COX6B1; SUTR: ASAH1 + 3'UTR: Gnas; SUTR: ASAH1 + 3'UTR: Ndufa1.1; SUTR: ASAH1 + 3UTR: PSMB3; SUTR: ASAH1 + 3'UTR: RPS9; SUTR: ATPSA1 + 3UTR: CASP1; SUTR: ATP5SA1 + 3'UTR: COX6B1; SUTR: ATPSA1 + 3UTR: Gnas; SUTR: ATPSA1 + 3'UTR: Ndufa1.1; S "UTR: ATPSA1 + 3UTR: PSMB3; SUTR: ATP5A1 + 3'UTR: RPS9; SUTR: HSD17B4 + 3UTR: CASP1; SUTR: HSD17B4 + 3'UTR: COX6B1; S'UTR: HSD17B4 + 3'UTR: Ndufa1. 1; SUTR: HSD17B4 + 3'UTR: PSMB3; SUTR: HSD17B4 + 3'UTR: RPS9; SUTR: Mp68 + 3'UTR: CASP1; SUTR: Mp68 + 3'UTR: COX6B1; SUTR: Mp68 + 3'UTR: Gnas; S "RTU: Mp68 + 3'UTR: Ndufa1.1; SUTR: Mp68 + 3'UTR: PSMB3; 5SUTR: Mp68 + 3'UTR: RPS9; SUTR: Ndufa4 + 3'UTR: CASP1; SUTR: Ndufa4 + 3UTR: COX6B1; SUTR: Ndufa4 + 3'UTR: Gnas; 5'UTR: Ndufa4 + 3UTR: Ndufa1.1; SUTR: Ndufa4 + 3'UTR: PSMB3; 5SUTR: Ndufa4 + 3'UTR: RPS9; SUTR: Nosip + 3'UTR: CASP1; SUTR: Nosip + 3UTR: COX6B1; SUTR: Nosip + 3'UTR: Gnas; 5UTR: Nosip + 3UTR: Ndufa1.1; SUTR: Nosip + 3'UTR: PSMB3; 5 "'RTU: Nosip + 3UTR: RPS9; SUTR: Rpl31 + 3UTR: CASP1; S'UTR: Rpl31 + 3UTR: COX6B1; S'UTR: Rpl31 + 3UTR: Gnas; SUTR: RpI31 + 3'UTR: Ndufa1.1 ; SUTR: Rpl31 + 3UTR: PSMB3; S'UTR: RpI31 + 3UTR: RPS9; SUTR: Slc7a3 + 3UTR: CASP1; S'UTR: Slc7a3 + 3UTR: COX6B1; S'UTR: Slc7a3 + 3UTR: Ndufa1.1; : Slc7a3 +
[00102] [00102] Each of the RTU elements defined in table 1 by reference to a specific SEQ ID NO can include variants or fragments of the nucleic acid sequence defined by said specific SEQ ID NO, presenting at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% , 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with the respective nucleic acid sequence defined by reference to its specific SEQ ID NO. Each of the sequences identified in table 1 by reference to its specific SEQ ID NO can also be defined by its corresponding DNA sequence, as indicated here. Each of the strings identified in table 1 by reference to their specific SEQ ID NO can be modified (optionally independently of each other) as described below.
[00103] [00103] Preferred artificial nucleic acids according to the invention can comprise: a-1. at least one element of the 5 'UTR derived from an S'UTR of an HSD17B4 gene, or from a corresponding RNA sequence
[00104] [00104] Particularly preferred artificial nucleic acids can comprise a combination of RTUs according to a-1, a-2, a-3, a-4 or a-5, preferably according to a-1.
[00105] [00105] Surprisingly, it has been found that certain combinations of 5 'and 3' untranslated regions (RTUs), as disclosed in this invention, work together to synergistically enhance the expression of operably linked nucleic acid sequences. The test for the synergy of RTU combinations is routine for a person versed in the technique, fe. a synergy test can be performed for Luciferase expression after MRNA transfection to prove that the synergy effects are present, that is, more than an additive effect. Liver expression
[00106] [00106] Any of the RTU combinations disclosed here is intended to modulate, preferably induce and, more preferably, intensify, the expression of an operably linked coding sequence (cds). Without wishing to be limited by the specific theory, some of the RTU combinations disclosed here can be particularly useful when used in connection with specific coding sequences and / or when used in connection with specific target cells or tissues.
[00107] [00107] In some embodiments, the artificial nucleic acid molecule according to the invention may comprise elements of the RTU according to a-2 (NDUFA4 / PSMB3); a-5 (MP68 / PSMB3); c-1 (NDUFAA4 / RPS9); a-1 (HSD17B4 / PSMB3); e-3 (MP68 / RPS9); e-4 (NOSIP / RPS9); a-4 (NOSIP / PSMB3); e-2 (RPL31 / RPS9); e-5 (ATP5A1 / RPS9); d-4 (HSD17B4 / NUDFA1); b-5 (NOSIP / COX6B1); a-3 (SLC7A3 / PSMB3); b-1 (UBQLN2 / RPS9); b-2 (ASAH1 / RPS9); b-4 (HSD17B4 / CASP1); e-6 (ATPSA1 / COX6B1); b-3 (HSD17B4 / RPS9); g-5 (RPL31 / CASP1); h-1 (RPL31 / COX6B1); and / or c-5 (ATP5A1 / PSMB3) as defined above. Such artificial nucleic acid molecules can be particularly useful for the expression of an encoded (poly-) peptide or protein of interest in the liver. Consequently, these artificial nucleic acid molecules are particularly intended for systemic administration, in particular intravenous, intraperitoneal, intramuscular or intratracheal administration or injection and, optionally, in combination with the hepatic targeting elements in this invention (as discussed) below). In addition, without wishing to imply any specific limitation, the RTU combinations mentioned above may be particularly useful for artificial nucleic acids that encode, in at least one coding region, a (poly-) peptide or therapeutic protein, one (polypeptide or antigenic or allergic protein as disclosed herein, for example, a protein useful in the treatment of a disease selected from the group consisting of genetic diseases, allergies, autoimmune diseases, infectious diseases, neoplasms, cancer and related diseases - nothing to the tumor, inflammatory diseases, blood diseases, blood-forming organs, endocrine, nutritional and metabolic diseases, diseases of the nervous system, diseases of the circulatory system, diseases of the respiratory system, diseases of the digestive system, skin diseases and subcutaneous tissue, diseases of the musculoskeletal system and connective tissue and diseases of the genitourinary system, regardless of whether they are inherited or acquired as, and their combinations.
[00108] [00108] In some embodiments, the artificial nucleic acid molecule according to the invention may comprise elements of the RTU according to a-1 (HSD17B4 / PSMB3); a-3 (SLC7A3 / PSMB3); e-2 (RPL31 / RPS9); a-5 (MP68 / PSMB3); d-1 (RPL31 / PSMB3); a-2 (NDUFA4 / PSMB3); h-1 (RPL31 / COX6B1); b-1 (UBQLN2 / RPS9); a- 4 (NOSIP / PSMB3); c-5 (ATPSA1 / PSMB3); b-5 (NOSIP / COX6B1); d-4 (HSD17B4 / NDUFA1); i-1 (SLC7A3 / RPS9); f-3 (HSD17B4 / COX6B1); b-4 (HSD17B4 / CASP1); g-5 (RPL31 / CASP1); c-2 (NOSIP / NDUFA1); e-4 (NOSIP / RPS9); c-4 (NDUFA4 / NDUFA1); and / or d-5 (SLC7A3 / NDUFA1) as defined above. Such artificial nucleic acid molecules can be particularly useful for the expression of an encoded (poly) peptide or protein of interest in the skin. Accordingly, such artificial nucleic acid molecules are particularly considered for intradermal administration, in particular topical, transdermal, intradermal injection, administration or subcutaneous or epicutaneous injection in this invention. In addition, without wishing to imply any particular limitation, the RTU combinations mentioned above can be particularly useful for artificial nucleic acids that encode, in at least one coding region, one
[00109] [00109] In some embodiments, the artificial nucleic acid molecule according to the invention may comprise elements of the RTU according to a-4 (NOSIP / PSMB3); a-1 (HSD17B4 / PSMB3); a-5 (MP68 / PSMB3); d-3 (SLC7A3 / GNAS); a-2 (NDUFA4 / PSMB3); a-3 (SLC7A3 / PSMB3); d-5 (SLC7A3 / NDUFAI); i-1 (SLC7A3 / RPS9); d-1 (RPL31 / PSMB3); d-4 (HSD1I7B4 / NDUFAI); b-3 (HSD17B4 / RPS9); f-3 (HSD17B4 / COX6B1); f-4 (HSD17B4 / GNAS); h-5 (SLC7A3 / COX6B1); g-4 (NOSIP / CASP1); c-3 (NDUFM / COX6B1); b-1 (UBQLN2 / RPS9); c-5 (ATPSA1 / PSMB3); h-4 (SLC7A3 / CASP1); h-2 (RPL31 / GNAS); e-1 (TUBB4B / RPS9); f-2 (ATP5A1 / NDUFA1); c-2 (NOSIP / NDUFA1); b-5 (NOSIP / COX6B1); and / or e-4 (NOSIP / RPS9) as defined above. Such artificial nucleic acid molecules can be particularly useful for the expression of an encoded (poly-) peptide or protein of interest in skeletal muscle, smooth muscle or cardiac muscle. Therefore, these artificial nucleic acid molecules are particularly considered for intramuscular administration, more preferably intra-injection.
[00110] [00110] In some embodiments, the artificial nucleic acid molecule according to the invention may comprise elements of the RTU according to e-1 (TUBB4B / RPS9); b-2 (ASAH1 / RPS9); c-3 (NDUFA4 / COX6B1); a-1 (HSD17B4 / PSMB3); c-4 (NDUFA4 / NDU-FA1); b-4 (HSD17B4 / CASP1); d-2 (ATPSA1 / CASP1); b-5 (NOSIP / COX6B1); a-2 (NDUFA4 / PSMB3); b-1 (UBQLN / RPS9); a-3 (SLC7A3 / PSMB3); f-4 (HSD17B4 / GNAS); c-2 (NOSIP / NDUFAI); b-3 (HSD1I7B4 / RPS9); c-5 (ATPSA1 / PSMB3); a-4 (NOSIP / PSMB3); d-5 (SLC7A3 / NDUFA1); or f-3 (HSD17B4 / COX6B1) as defined above. Such artificial nucleic acid molecules can be particularly useful for the expression of a (poly) peptide or protein of interest in a tumor or cancer cell, including carcinoma, sarcoma, lymphoma, leukemia, germ cell tumor or cancer cells. blastoma. Consequently, these artificial nucleic acid molecules are particularly considered for intratumor, intramuscular, subcutaneous, intravenous, intradermal, intraperitoneal, intrapleural, intraosseous administration or injection in this invention. In addition, without wishing to imply any particular limitation, the RTU combinations mentioned above may be particularly useful for artificial nucleic acids that encode, in at least one coding region, a therapeutic (poly-) peptide or protein, one (antigenic or allergic polypeptide or protein as disclosed herein, for example, a protein useful in the treatment of a disease selected from the group consisting of a cancer or tumor disease.
[00111] [00111] In some embodiments, the artificial nucleic acid molecule according to the invention may comprise elements of the RTU according to b-2 (ASAH1 / RPS9); c-1 (NDUFA4 / RPS9.1); e-3 (MP68 / RPS9); c-4 (NDUFA4 / NDUFA1); c-2 (NOSIP / NDUFA1); h-2 (RPL31 / CASP1); d-2 (ATPSA1 / CASP1); b-3 (HSD17B4 / RPS9); a-2 (NDUFAA4 / PSMB3); f-4 (HSD17B4 / GNAS); d-3 (SLC7A3 / GNAS); g-1 (MP68 / NDUFA1); c-3 (NDUFA4 / COX6B1); e-5 (ATP5SA1 / RPS9); h-3 (RPL31 / NDUFA1); a-1 (HSD17B4 / PSMB3); a-5 (MP68 / PSMB3); g-4 (NOSIP / CASP1); b-1 (UABLN / RPS9); d-4 (HSD17B4 / NDUFA1); or e-2 (RPL31 / RPS9) as defined above. Such artificial nucleic acid molecules can be particularly useful for the expression of a (poly-) peptide or protein of interest in renal cells. Accordingly, these artificial nucleic acid molecules are particularly considered for systemic administration, in particular intravenous, intraperitoneal, intramuscular or intratracheal administration or injection and, optionally, in combination with the renal targeting elements in this invention. In addition, without wishing to imply any specific limitation, the RTU combinations mentioned above may be particularly useful for artificial nucleic acids that encode, in at least one coding region, a (poly-) peptide or therapeutic protein, one ( poly) antigenic or allergic peptide or protein as disclosed herein, for example, a protein useful in the treatment of a disease selected from the group consisting of genetic diseases, allergies, autoimmune diseases, infectious diseases, neoplasms, cancer and tumor-related diseases , inflammatory diseases, diseases of the blood and blood-forming organs, endocrine, nutritional and metabolic diseases, diseases of the nervous system, diseases of the circulatory system, diseases of the respiratory system, diseases of the digestive system, diseases of the skin and subcutaneous tissue, diseases of the musculoskeletal system and connective tissue and diseases of the genitourinary system, regardless of whether they are inherited or acquired and their combinations.
[00112] [00112] In view of the above, artificial nucleic acid molecules according to the invention can be defined as indicated above, wherein - said element of the SUTR derived from an HSD17B4 gene comprises or consists of a DNA sequence according to SEQ ID NO: 1 or a DNA sequence having, in ascending order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 1, or a fragment or variant thereof; or an RNA sequence according to SEQ ID NO: 2, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96% , 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 2, or a fragment or variant thereof; - said element of the SUTR derived from an ASAH1 gene comprises or consists of a DNA sequence according to SEQ ID NO: 3 or a DNA sequence having, in increasing order of preference, at least 50%, 60%, 70% , 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 3, or a fragment or variant thereof; or an RNA sequence according to SEQ ID NO: 4, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 4, or a fragment or a variant thereof;
[00113] [00113] The artificial nucleic acid according to the invention comprises
[00114] [00114] The (polypeptides or proteins of interest generally include any (poly) peptides or proteins that can be encoded by the nucleic acid sequence of at least one coding region and can be expressed under conditions suitable to produce a (poly) In this context, the term "functional" means "capable of exercising a desired biological function" and / or "having a desired biological property." The (polypeptides or proteins of interest can have several functions and include, for example, antibodies, enzymes, signaling proteins, receptors, receptor ligands, peptide hormones, transport proteins, structural proteins, neurotransmitters, growth regulating factors, serum proteins, vehicles, drugs, immunomodulators , oncogenes, tumor suppressors, toxins, tumor antigens, etc. These proteins can be post-translational modified to be proteins, glycoproteins, lipoprot eines, phosphoproteins, etc. In addition, the invention provides for any of the (poly) peptides or proteins disclosed in their natural (wild-type) form, as well as variants, fragments and derivatives. The encoded (poly) peptides and proteins can have different effects. Without limiting itself to this, the coding regions that encode therapeutic, antigenic and allergenic (poly) peptides are particularly contemplated here. Therapeutic (poly) peptides or proteins
[00115] [00115] The at least one coding region of the artificial nucleic acid molecule of the invention can encode at least one "(poly) peptide or therapeutic protein". The term "(poly) peptide or therapeutic protein" refers to a (poly) peptide or protein capable of mediating a desirable diagnostic, prophylactic or therapeutic effect, preferably resulting in the detection, prevention, improvement and / or cure of a disease.
[00116] [00116] Preferably, the artificial nucleic acid molecules according to the invention can comprise at least one coding region that encodes a therapeutic protein that replaces a missing, deficient or mutated protein; a therapeutic protein beneficial for the treatment of inherited or acquired diseases; infectious diseases or neoplasms, for example, cancerous or tumoral diseases; an adjuvant or immunostimulatory therapeutic protein; a therapeutic antibody or antibody fragment, antibody variant or derivative; a peptide hormone; a gene editing agent; an immune checkpoint inhibitor;
[00117] [00117] The "(therapeutic polypeptides or proteins that replace a missing, deficient or mutated protein" can be selected from any (poly) peptide or protein that has the desired biological properties and / or capable of exerting the desired biological function of a wild-type protein, the absence, deficiency or mutation of which causes disease. Here, "absent" means that expression of the protein from its coding gene is prevented or abolished, typically to the point where the protein is not be detectable at its target site (ie cell compartment, cell type, tissue or organ) in the body of the affected individual. Protein expression can be affected at several levels, and "absence" or "lack" of production "of a protein in an affected patient's body may be due to mutations in the coding gene, for example, epigenetic changes or sequence mutations, its open reading structure or its regulatory elements (for example o, meaningless mutations or deletions that lead to the impediment or revocation of gene transcription), defective mRNA processing (for example, defective mRNA junction, maturation or export of the nucleus), protein translation deficiencies or errors in the folding process, translocation (that is, failure to correctly insert the secretory pathway) or transport (that is, failure to correctly insert the intended export pathway) of proteins. A protein "deficiency", that is, a reduced amount of protein detectable at the target site (ie cell compartment, type of cell, tissue or organ) in the body of the affected individual, can be caused by the same mechanisms responsible by the complete lack of protein expression as exemplified above. However, defects that lead to a protein "deficiency" may not always prevent or completely abolish the protein expression of the affected gene, but lead to reduced levels of expression (for example, in cases where an allele is affected and the other works normally). The term "subjected to mutation" encompasses both amino acid sequence variants and differences in post-translational protein modification. Protein "mutants" may not normally be functional or malfunctional and may have aberrant folding, translocation or transport properties or profiles.
[00118] [00118] The (therapeutic polypeptides or proteins "beneficial for the treatment of inherited or acquired diseases, such as infectious diseases or neoplasms, for example, cancerous or tumoral diseases, diseases of the blood and blood-forming organs, - endocrine, nutritional and metabolic diseases, diseases of the nervous system, diseases of the circulatory system, diseases of the respiratory system, diseases of the digestive system, diseases of the skin and subcutaneous tissue, diseases of the musculoskeletal system and connective tissue and diseases of the genitourinary system, regardless of whether they are inherited or acquired "include any (poly) peptide or protein whose expression is capable of preventing, ameliorating or curing a hereditary disease or acquired diseases. Such (poly) peptides or proteins may - they must, in principle, exercise their therapeutic function by exercising any appropriate biological action or function In some modalities, such (poly) peptides or proteins may preferably not acting to replace a protein that is absent, deficient or subjected to mutation and / or inducing an immune or allergenic response. For example, (polypeptides or proteins beneficial for the treatment of inherited or acquired diseases, such as infectious diseases or neoplasms, may include particularly preferred therapeutic proteins, which are, inter alia, beneficial in the treatment of metabolic or endocrine disorders acquired or inherited selected from (in parentheses the particular disease for which the therapeutic protein is used in the treatment): acid sphingomyelinase (Niemann-Pick disease), adipotide (obesity), agalsidase-beta (human galactosidase A) (Fabry's disease; prevents the accumulation of lipids that can lead to renal and cardiovascular complications), Alglucosidase (Pompe's disease (glycogen storage disease type | l)), alpha-galactosidase A (alpha-GAL A, Agalsidase alpha) (Fabry's disease), alpha-glucosidase (glycogen storage disease (GSD), Morbus Pompe), alpha-L-iduronidase (mucopolysaccharidoses (MPS), Hurler's syndrome, Scheie's syndrome), alpha-N-acetyl glucosaminidase (Sanfilippo syndrome), amphiregulin (cancer, metabolic disorder), angiopoietin ((Ang1, Ang2, Ang3, Ang4, ANGPTL2, ANGPTL3, ANGPTLA4, ANG-PTL5, ANGPTL6, ANGPTL7) (angiogenesis, stabilize vessels), ( angiogenesis, stabilizing vessels), Betacellulin (metabolic disorder), Beta-glucuronidase (Sly syndrome), bone morphogenetic protein BMPs (BMP1, BMP2, BMP3, BMP4, BMP5, BMP6, BMP7, BMP8a, BMP8b, BMP10, BMP15) (regenerative effect, bone-related conditions, chronic kidney disease (CKD)), CLN6 protein (atypical late childhood CLNG6 disease), late onset variant, early juveniles, Neuronal Ceroid Lipofuscinosis (NCL)), Growth factor epidermal (EGF) (wound healing, regulation of cell growth, proliferation and differentiation), Epigenic (metabolic disorder), Epiregulin (metabolic disorder), Fibroblast Growth Factor (FGF, FGF-1, FGF-2, FGF -3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11, FGF- 12, FGF-13, FGF-14, FGF-16, FGF-17, FGF-17, FGF-18, FGF-19, FGF-20, FGF-21, FGF-22, FGF-23) (healing) wounds, angiogenesis, endocrine disorders, tissue regeneration), galsulfase (mucopolysaccharidosis VI), ghrelin (irritable bowel syndrome (IBS), obesity, Prader-Willi syndrome, type 1I diabetes mellitus), glucocerebrosidase (disease Gaucher), GM-
[00119] [00119] It is understood that these and other proteins are therapeutic, since they are intended to treat the individual by replacing his defective endogenous production of a functional protein in sufficient quantities.
[00120] [00120] Consequently, these therapeutic proteins are typically mammalian, in particular human proteins.
[00121] [00121] For the treatment of acquired or inherited blood disorders, diseases of the circulatory system, diseases of the respiratory system, diseases of cancer or tumor, infectious diseases or immune deficiencies, the following therapeutic proteins can be used (among parenthesis is the particular disease for which a use of therapeutic protein is indicated for treatment): Alteplase (tissue plasminogen activator; tPA) (pulmonary embolism, myocardial infarction, acute ischemic stroke, occlusion of devices central venous access), Anistreplase (thrombolysis), Antithrombin Ill (AT-I1) (Hereditary AT-IIl deficiency, thromboembolism), Bivalirudin (reduce the risk of blood clotting in coronary angioplasty and heparin-induced thrombocytopenia), Darbepoetin alfa ( treatment of anemia in patients with chronic renal failure) (+/- dialysis)), Drotrecogin-alpha (activated protein C) (severe sepsis with a high risk of death), erythropoietin, Epoetin-alpha, Erythropoietin, Erythropoietin (Anemia of chronic disease, myelodysplasia, anemia due to renal failure or chemotherapy, preoperative preparation), Factor IX (hemophilia B), Factor Villa (hemorrhage in patients with hemophilia A or B and inhibitors factor VIII or factor IX), Factor VIII (Hemophilia A), Lepirudin (heparin-induced thrombocytopenia), protein C concentrate (venous thrombosis, Purpura fulminans), Reteplase (mutein deletion of tPA) (control of infarction myocardial infarction, improvement in ventricular function), Streptocuinase (acute myocardial infarction in transmural evolution, pulmonary embolism, deep venous thrombosis, arterial thrombosis or embolism, arteriovenous cannula occlusion), Tenecteplase (acute myocardial infarction), Urokinase ( pulmonary embolism), angiostatin (cancer), anti-CD22 immunotoxin (acute myeloid leukemia CD33 + relapse), Denileukin diphthytox (cutaneous T-cell lymphoma (CTCL)), immunocyanin (bladder and prostate cancer), MPS (metallopathy) nstimulin) (cancer), Aflibercept (not small) non-small lung cancer
[00122] [00122] Other therapeutic (poly) peptides or proteins can be selected from: OATL3, OFC3, OPA3, OPD2, 4-1BBL, 574, 6Ckine, 707-AP, 9D7, A2M, AA, AAAS, AACT, AASS, ABAT, ABCA1, ABCAA, ABCB1, ABCB11, ABCB2, ABCB4, ABCB7, ABCC2, ABCC6, ABCCB8, ABCD1, ABCD3, ABCG5, ABCG8, ABL1, ABO, ABR ACAA1, ACACA, ACADL, ACADM, ACADS, ACADVL, ACAT, ACAT1 , ACHE, ACHM3, ACHM1, ACLS, ACPI, ACTA1I, ACTC, ACTNA4, ACVRLI, AD2, ADA, ADAMTS13, ADAMTS2, ADFN, ADH1B, ADHIC, ADLDH3A2, ADRB2, ADRB3, ADSL, AEZ, AFA, AFA, AFD1, , AGL, AGMX2, AGPS, AGS1, AGT, AGTR1, AGXT, AHO2, AHCY, AHDS, AHHR, AHSG, AIC, AIED, AIH2, AIH3, AIM-2, AIPL1, AIRE, AK1, ALAD, ALAS2, ALB, HPG1 , ALDH2, ALDH3A2, ALDHA4A1,
[00123] [00123] Additional therapeutic (poly) peptides or proteins may be selected from apoptotic factors or apoptosis-related proteins, including AIF, Apaf, for example, Apaf-1, Apaf-2, Apaf-3, oder APO- 2 (L), APO-3 (L), Apopain, Bad, Bak, Bax, Bcl-2, Becl- x [L], Bel-x [s], bik, CAD, Calpain, Caspase, for example, Caspase -1, Caspase-2, Caspase-3, Caspase-4, Caspase-5, Caspase-6, Caspase-7, Caspase-8, Caspase-9, Caspase-10, Caspase-1 1, ced- 3, ced- 9, c-Jun, c-Myc, crm A, cytochrome C, CdR1, DcR1, DD, DED, DISC, DNA-PKcIS], DR3, DR4, DR5, FADD / MORT-1, FAK, Fas (Fas- ligand CD95 / fas (receiver)), FLICE / MACH, FLIP, fodrin, fos, G-Actin, Gas-2, gelsolin, granzyme A / B, ICAD, ICE, JNK, lamina A / B, MAP, MCL-1, Mdm-2, MEKK-1, MORT-1, NEDD, NF- [kappa] B, NuMa, p53, PAK- 2, PARP, perforin, PITSLRE, PKCdelta, pRb, presenilin, prl- CE, RAIDD, Ras, RIP , sphingomyelinase, herpes simplex thymidincinase, TRADD, TRAF2, TRAIL-R1, TRAIL-R2, TRAIL-R3, transglutaminase , etc., or an isoform, homolog, fragment, variant or derivative of any of these proteins.
[00124] [00124] An "adjuvant" (poly) ipeptide or protein generally means any (poly) peptide or protein capable of modifying the effect of other agents, typically other active agents that are administered simultaneously. Preferably, "adjuvant or immunostimulant" (poly) peptides or proteins are able to potentiate or modulate a desired immune response to an antigen (preferably co-administered). In particular, an "adjuvant or immunostimulatory" (poly) peptide or protein can act to accelerate, prolong or enhance immune responses when used in combination with specific antigens. To that end, "adjuvant or immunostimulating" (poly) peptides or proteins can support the administration and release of coadministered antigens, enhance the immunostimulatory (antigen-specific) properties of the coadministered antigens and / or initiate or increase a response immune system of the innate immune system, that is, a non-specific immune response.
[00125] [00125] The (polypeptides, adjuvant proteins (preferably mammals) or proteins can still be selected from the group consisting of heat shock proteins, such as HSP10, HSP60, HSP65, HSP70, HSP75 and HSP90, gp96, fibrinogen, Typlll extra repeat domain A of fibronectin; or components of the complement system, including C1g, MBL, C1r, C1is, C2b, Bb, D, MASP-1, MASP-2, C4b, C3b, C5a, C3a, C4a, C5b , C6, C7, C8, C9, CR1, CR2, CR3, CR4, C1gR, C1INH, C4bp, MCP, DAF, H, |, Pe CD59, or induced target genes, including, for example, Beta-Defensin, cell surface, or human adjuvant proteins, including trif, flt-3 ligand, Gp96 or fibronectin, etc., or an isoform, homolog, fragment, variant or derivative of any of these proteins.
[00126] [00126] The (adjuvant polypeptides or proteins (preferably mammals) or proteins can further be selected from the group consisting of cytokines that induce or enhance an innate immune response, including IL-1 alpha, IL1 beta, IL-2, IL-6 , IL-7, I1L-8, IL-9, 11-12, IL-13, I1L-15, I1L-16, I1L-17, 11-18, 11-21, 11-23, TNFalfa, IFNalfa, IFNbeta , IFNgama, GM-CSF, G-CSF, M-CSF; chemokines including IL-8, IP-10, MCP-1, MIP-1alpha, RANTES, Eotaxin, CCL21; cytokines that are released from macrophages, including IL -1, IL-6, IL-8, I1L-12 and TNF-alpha; IL-1R1 and | L-1 alpha, or an isoform, homolog, fragment, variant or derivative of any of these proteins.
[00127] [00127] The term "antibody" (Ab), as used in this invention, includes monoclonal antibodies, polyclonal antibodies, mono and multispecific antibodies (for example, bispecific antibodies) and fragments, variants and derivatives of antibodies, provided that it has the desired biological function, which is typically the ability to specifically bind to a target. The term "specific binding", as used herein, means that the antibody binds more easily to its intended target than to a different, non-specific target. In other words, the antibody "specifically binds" or exhibits "binding specificity" to its target if it preferably binds or recognizes the target even in the presence of non-measurable targets by a quantifiable assay (such as radial ligand binding assays - active ingredients, ELISA, fluorescence-based techniques (eg fluorescence polarization (FP), fluorescence resonance energy transfer (FRET)) or surface plasmon resonance). An antibody that "specifically binds" to its target may or may not have shown cross-reactivity with targets (homologues) derived from different species.
[00128] [00128] The naturally occurring basic antibody is a heterotetrameric glycoprotein composed of two identical light (L) chains and two identical heavy (H) chains. Some antibodies may contain additional polypeptide chains, such as the J chain on IgM and IgA antibodies. Each L chain is linked to an H chain by a covalent disulfide bond, while the two H chains are linked together by one or more disulfide bonds, depending on the H chain isotype. Each H and L chain also comprises bridges of intrachain disulfide. Each H chain comprises an N-terminal variable domain (V4), followed by three constant domains (Cr) for each of the a and y chains and four Cn domains for the p and £ € isotypes. Each L chain has a variable domain (V.) at the N-terminal followed by a constant domain at its other end. V is aligned with Vx and Cr is aligned with the first constant domain of the heavy chain (Cr1). It is believed that the particular amino acid residues form an interface between the light and heavy chain variable domains.
[00129] [00129] The L chain of any vertebrate species can be attributed to one of two clearly distinct types, called kappa and lambda, based on the amino acid sequences of its constant domains. Depending on the amino acid sequence of the constant domain of their heavy chains (Cr), immunoglobulins can be assigned to different classes or isotypes. There are five classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM, having heavy chains designated a, 8, e, y and u, respectively. The y and yu classes are further divided into subclasses based on relatively small differences in the sequence and function of Cn, for example, human beings express the following subclasses: I9G1, IgG2, I9gG3, IgG4, IgA1 and IgA2.
[00130] [00130] The pairing of a Vr and VL together forms a single antigen binding site. The term "variable" refers to the fact that certain segments of the variable domains differ extensively in sequence between antibodies. The V domain mediates binding to the antigen and defines the specificity of a specific antibody to its specific antigen. However, variability is not evenly distributed across the range of variable domains. Instead, V regions consist of relatively invariant stretches called structural regions (FRs) of about 15 to 30 amino acid residues separated by shorter regions of extreme variability called "hypervariable regions", also called " complementarity determining regions "(CDRs), each approximately 9 to 12 amino acid residues in length. The variable domains of the native heavy and light chains comprise four FRs, largely adopting a B-blade configuration, connected by three hypervariable regions, which form connecting loops and, in some cases, form part of the B-blade structure. hypervariable regions in each chain are held together by the FRs and, with the hypervariable regions of the other chain, contribute to the formation of the antibody antigen binding site. The constant domains are not directly involved in the binding of an antibody to an antigen, but have several effector functions, such as the participation of antibody-dependent cell cytotoxicity (ADCC). The term "hypervariable region" (also known as "complementarity determining regions" or CDRs), when used in this invention, refers to the amino acid residues of an antibody that are (usually three or four short regions of extreme variability) sequence) within the V region domain of an immunoglobulin that forms the antigen binding site and are the main determinants of the specificity of antigen binding. CDR residues can be identified based on cross-species sequence variability or crystallographic studies of antigen-antibody complexes.
[00131] [00131] The term "antibody" as used herein, preferably refers to immunoglobulin molecules, or variants, fragments or derivatives, which are able to specifically bind to a target epitope by means of at least one determining region of complementarity. The term includes mono- and polyclonal antibodies, mono, bi and multispecific antibodies, antibodies of any isotype, including IgM, IgD, IgG, IgA and IgE antibodies and antibodies obtained by any means, including naturally occurring antibodies, antibodies generated by immunization in a host organism, antibodies that have been isolated and identified from naturally occurring antibodies or antibodies generated by immunization in a host organism and produced recombinantly by biomolecular methods known in the art, as well as chimeric antibodies, antibodies humans, humanized antibodies, intrabodies, that is, antibodies expressed in cells and optionally located in specific cell compartments, as well as variants, fragments and derivatives of any of these antibodies.
[00132] [00132] The term "monoclonal antibody" (mab) as used herein, refers to an antibody obtained from a population of substantially homogeneous antibodies, that is, the individual antibodies that comprise the population are identical, except for possible naturally occurring mutations that may be present in small quantities. Monoclonal antibodies are highly specific, being directed against a single antigenic site. In addition, in contrast to "polyclonal" antibody preparations that include different antibodies directed against different epitopes, each monoclonal antibody is directed against a single epitope on the antigen. In addition to their specificity, monoclonal antibodies are advantageous, as they can be synthesized without being contaminated by other antibodies. The adjective "monoclonal" should not be interpreted as requiring the production of the antibody by any specific method. For example, monoclonal antibodies useful in the present invention can be prepared by the hybridoma methodology first described by Kohler et al., Nature 256: 495 (1975), or can be produced using recombinant DNA methods - bacterial or eukaryotic animal or vegetable squid (see, for example, US Pat. No. 4,816,567). "Monoclonal antibodies" can also be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature 352: 624-628 (1991) and Marks et al., J. Mol. Biol. 222: 581-597 (1991), for example.
[00133] [00133] Monoclonal antibodies include "chimeric" antibodies in which a part of the heavy and / or light chain is identical or homologous to the corresponding sequences in antibodies derived from a specific species or belonging to a specific class or subclass of antibody , while the rest of the chain is identical or homogeneous
[00134] [00134] An "antibody variant" or "antibody mutant" refers to an antibody that comprises or consists of an amino acid sequence in which one or more of the amino acid residues have been modified compared to a reference antibody or "source". Such antibody variants may show, in increasing order of preference, at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, preferably at least about 70%, 80%, 85%, 86%, 87%, 88%, 89%, more preferably at least about 90%, 91%, 92%, 93%, 94%, most preferably at least about 95%, 96%, 97 %, 98% or 99% sequence identity for a reference or "source" antibody, or for its light or heavy chain. Conceivable amino acid mutations include deletions,
[00135] An "antibody fragment" comprises a portion of an intact antibody (i.e., an antibody comprising an antigen binding site, as well as a Cr and at least the heavy chain domains, CH1, CH2 and Crx3 ), preferably binding to the antigen and / or the variable region of the intact antibody. Examples of antibody fragments include Fab, Fab ', F (ab') 2 and Fv fragments; diabodies; linear antibodies, single chain antibodies, and bi- or multi-specific antibodies comprising such antibody fragments.
[00136] [00136] The digestion of antibodies by papain produced two identical fragments of antigen binding, called "Fab" fragments (fragment, antigen binding) and a residual "Fc" fragment (fragment, crystallizable). The Fab fragment consists of an entire L chain, together with the H chain variable region domain (Vu) and the first heavy chain constant domain (Cr1). Each Fab fragment is monovalent with respect to antigen binding, that is, it has a single antigen binding site. Pepsin treatment of an antibody produces a single large F (ab ') fragment that corresponds approximately to two disulfide-bound Fab fragments having different antigen-binding activity and is still capable of mirroring the antigen and a fragment of pFc '. The F (ab ') fragment can be divided into two Fab' fragments. Fab 'fragments differ from Fab fragments in that they have some additional residues at the carboxy terminus of the Cr1 domain, including one or more cysteines from the do-
[00137] [00137] The Fc fragment comprises the carboxy-terminal components of both H chains held together by disulfides. The effector functions of antibodies are determined by sequences in the Fc region, a region that is also recognized by the Fc receptors (FcR) found in certain types of cells.
[00138] [00138] "Fv" is the minimum antibody fragment that contains a complete antigen-binding site. This fragment consists of a dimer of a heavy chain and light chain variable domain domain in close and non-covalent association. From the folding of these two domains, six hypervariable calibrated loops emanate (3 calibrated loops, each of the H and L chains) that contribute to the amino acid residues for antigen binding and confer specificity to the antigen binding in the antibody. . However, even a single variable domain (or half a Fv comprising only three antigen-specific CDRs) has the ability to recognize and bind to the antigen, albeit with a lower affinity than the entire binding site.
[00139] [00139] "Single chain Fv" also abbreviated as "sFv" or "scFv" are antibody fragments that comprise the VH and VL antibody domains connected to a single polypeptide chain. Preferably, the sFv polypeptide further comprises a polypeptide linker
[00140] [00140] The term "diabody" (also known as divalent (or bivalent) single-chain variable fragments, "di-scFvs", "bi-scFvs") refers to fragments of antibodies prepared by the binding of two fragments of scFv (see the previous paragraph), typically with short ligands (about 5 to 10 residues) between the Vx and Vr domains, in such a way that the interchanged, but not intracranial, matching of the V domains is achieved. Another possibility is to build a single peptide chain with two Vn regions and two V regions ("tandem scFv). The resulting divalent fragments have two antigen-binding sites. Likewise, trivalent scFv trimers (also called "tri-bodies" or "tri-bodies") and tetravalent scFv tetramers ("tetribodies"). Antibodies or fragments of di- or multivalent antibodies can be monospecific, that is, each antigen-binding site can be targeted against Such monospecific or multivalent antibodies or antibody fragments preferably have high binding affinities Alternatively, the antigen binding sites of di or multivalent antibody fragments can be directed against different targets, forming antibodies or fragments of bi or multispecific antibodies.
[00141] [00141] "Bi or multispecific antibodies or antibody fragments" comprise more than one specific antigen-binding region, each capable of specifically binding to a different target. "Bispecific antibodies" are typically heterodimers of two "crossed" scFv fragments in which the Vu and Vi domains of the two antibodies are present in different polypeptide chains. Bi or multispecific antibodies can act as adapter molecules between an effector and a respective target, thus recruiting effects.
[00142] Preferred antibody-encoding artificial nucleic acid molecules of the invention may preferably comprise a coding region comprising or consisting of a nucleic acid sequence according to any of SEQ ID NO: 1 to 61734 or respectively Table 3, Table 4, Table 5, Table 6 or Table 9, as described in the international patent application.
[00143] [00143] The artificial nucleic acid molecules of the invention that encode preferred therapeutic proteins can preferably comprise a coding region that comprises or consists of a nucleic acid sequence according to any of SEQ ID NO, as shown in SEQ ID NO: 1 to SEQ ID NO: 345916 or respectively the Table | as described in US patent application 15 / 585,561, in particular a nucleic acid sequence that is identical or with a sequence identity of at least 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97%, 98% or 99%, preferably at least 80%, to those sequences or a fragment or variant of any of those RNA sequences. In this context, the disclosure of U.S. Order No. 15 / 585,561 is also incorporated herein by reference. The person skilled in the art knows that also other (redundant) mRNA sequences can encode proteins as shown in the reference above, so mRNA sequences are not limited to them.
[00144] [00144] Other artificial nucleic acid molecules of the invention that encode preferred therapeutic proteins can preferably comprise a coding region that comprises or consists of a nucleic acid sequence according to any of SEQ ID NO, as shown in SEQ ID NO: 1 to SEQ ID NO: 345916 or respectively, the Table | as described in international patent application POCT / EP2017 / 060692, in particular a nucleic acid sequence being identical or having a sequence identity of at least 50%, 60%, 70%, 80%, 81%, 82% , 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 97%, 98 % or 99%, preferably at least 80%, with those sequences or a fragment or variant of any one of these RNA sequences. In this context, the disclosure of the international patent application POT / EP2017 / 060692 is also incorporated herein by reference. The person skilled in the art knows that other mRNA sequences (redundant) can also encode proteins as shown in the reference above, therefore, MRNA sequences are not limited to them.
[00145] [00145] The term "peptide hormone" refers to a class of peptides or proteins that have endocrine functions in live animals. Typically, peptide hormones perform their functions by binding to receptors on the surface of target cells and transmitting signals through second intracellular messengers. Exemplary peptide hormones include Adiponectin, that is, Acrp30; Adrenocorticotropic hormone (or corticotropin), that is, ACTH; Amylin (or islet amyloid polypeptide), that is, IAPP; Angiotensinogen and angiotensin, that is, AGT; Anti-Mullerian hormone (or Mullerian inhibiting factor or hormone), that is, AMH; Antidiuretic hormone (or vasopressin, arginine vasopressin), that is, ADH; Atrial-natriuretic peptide (or atriopeptin), that is, ANP; Cerebral natriuretic peptide, i.e., BNP; Calcitonin, i.e., CT; Cholecystokinin, i.e., CCK; Corticotropin-releasing hormone, that is, CRH; Cortistatin, that is, CORT; Endothelin, that is; Enkephalin, that is; Erythropoietin, that is, EPO; Follicle stimulating hormone, that is, FSH; Galanine, that is, GAL; Gastric inhibitor polypeptide, i.e., GIP; Gastrin, that is, GAS; Ghrelin, that is; Glucagon, that is, GCG; Glucagon-like peptide-1, i.e., GLP1; Gonadotropin-releasing hormone, that is, GNRH; Growth hormone, that is, GH or hGH; Growth hormone releasing hormone, that is, GHRH; Guaniline, that is, GN; Hepcidin, that is, HAMP; Human chorionic gonadotropin, that is, hCG; Human placental lactogen, that is, HPL; Inhibin, that is; Insulin, that is, INS; Insulin-like growth factor (or soomomedine), that is, IGF; Leptin, that is, LEP; Lipotropin, that is, LPH; Luteinizing hormone, that is, LH; Melonocyte-stimulating hormone, that is, MSH or a-MSH; Motilin, that is, MLN; Orexin, that is; Osteocalcin, that is, OCN; Oxytocin, that is, OXT; Pan-pancreatic polypeptide, that is, parathyroid hormone, that is, PTH; Pituitary adenylate cyclase activation peptide, i.e., PACAP; Prolactin, that is, PRL; Prolactin-releasing hormone, that is, PRH; Relaxin, that is, RLN; Renina, that is; Secretin, that is, SCT; Somatostatin, that is, SRIF; Thrombopoietin, that is, TPO; Thyroid-stimulating hormone (or thyrotropin), that is, TSH; Thyrotropin-releasing hormone, that is, HRT; Uroguaniline, that is, UGN; or vasoactive intestinal peptide, that is, VIP, or an isoform, homolog, fragment, variant or derivative of any of these proteins.
[00146] [00146] The term "gene editing agent" refers to (polypeptides or proteins that are capable of modifying (ie altering, inducing, increasing, reducing, suppressing, abolishing or preventing) the expression of a gene Gene expression can be modified at several levels Gene editing agents can typically act (a) by introducing or removing epigenetic modifications, (b) altering the sequence of genes, for example, by introducing, excluding or alteration of nucleic acid residues in the nucleic acid sequence of a gene of interest, (c) modifying the biological function of regulatory elements operably linked to the gene of interest, (d) modifying transcription, processing, splicing, maturing or exporting mRNA in the cytoplasm, (e) modifying mMRNA translation, (f) modifying post-translational modifications, (9) modifying protein translocation or export. the term "gene editing agent s "can refer to (poly) peptides or proteins directed to a cell's genome to modify gene expression, preferably performing functions (a) - (d), more preferably (a) - (c). The term "gene editing agent", as used herein, preferably includes gene editing agents that cleave or alter the target DNA to induce mutation (for example, by means of homologous targeted repair or non-homologous end splice), but also includes gene editing agents that can reduce expression in the absence of target cleavage (for example, gene editing agents that are fused or conjugated to expression modulators, such as transcriptional repressors or epigenetic modifiers that can reduce gene expression). Specific gene editing agents include: transcription activators, transcription repressors, recombinases, nucleases, DNA-binding proteins or combinations thereof.
[00147] [00147] The present invention also relates to artificial nucleic acids, in particular RNAs, which encode proteins associated with CRISPR and (pharmaceutical) compositions and kits of parts comprising them. Said artificial nucleic acids, in particular RNAs, compositions (pharmaceuticals) and kits are, inter alia, intended for use in medicine, for example, in gene therapy and, in particular, in the treatment and / or prophylaxis of diseases that can be treated with proteins associated with CRISPR, for example, through gene editing, gene replacement, neutralization or modulation of the expression of target genes of interest.
[00148] [00148] The term "CRISPR-associated protein" refers to RNA-guided endo-nucleases that are part of a CRISPR system (Short Palindromic Repetitions Interleaved Regularly in Cluter) (and their counterparts, variants, fragments or derivatives) , which is used by prokaryotes to provide adaptive immunity against foreign DNA elements. CRISPR-associated proteins include, without limitation, Cas9, Cpf1 (Cas12), C2c1, C2c3, C2c2, Cas13, CasX and CasY. As used in this invention, the term "CRISPR-associated protein" includes wild-type proteins, as well as homologues, variants, fragments and derivatives. Therefore, when referring to the artificial nucleic acid molecules encoding Cas9, Cpf1 (Cas12), C2c1, C2c3 and C2c2, Cas13, CasX and CasY, said artificial nucleic acid molecules can encode the respective wild-type proteins, or their counterparts , variants, fragments and derivatives.
[00149] [00149] Preferably, the at least one element of the 5 RTU and the at least one element of the 3'UTR act synergistically to increase the expression of at least one coding sequence | operably linked to said RTUs. It is envisaged in this invention to use the 5-RTU and 3-RTU recited in any useful combination. Other particularly preferred embodiments of the invention include the combination of CDS of choice, that is, a CDS selected from the group consisting of Cas9, Cpf1, CasX, CasY and Cas13 with a combination of RTU selected from the group of HSD17B4 / Gnas .1; Slc7a3.1 / Gnas.1; ATPSA1 / CASP.1; Ndufa4.1 / PSMB3.1; HSD17B4 / PSMB3.1; RPL32var / albumin7; 3214 / albumin7; HSD17B4 / CASP1.1; Slc7a3.1 / CASP1.1; Sic7a3.1 / PSMB3.1; No.1 / PSMB3.1; Ndufa4.1 / RPS9.1; HSD17B4 / RPS9.1; ATPSA1 / Gnas.1; Ndufa4.1 / COX6B1.1; Ndufa4.1 / Gnas.1; Ndufa4.1 / Ndu-
[00150] [00150] The term "immune checkpoint inhibitor" refers to any (poly) peptide or protein capable of inhibiting (ie, interfering with blocking, neutralizing, reducing, suppressing, abolishing, preventing) biological activity of an immune checkpoint protein. Immune checkpoint proteins typically regulate T cell activation or function and are well known in the art. Immune checkpoint proteins include, without limitation, CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-L1 (B7-H1, CD274), B7-H4, B7-H6 , 2B4, ICOS, HVEM, PD-L2 (B7-DC, CD273), CD2, CD27, CD28, CD30, CD40, CD70, CD80, CD86, CD137, CD160, CD226, CD276, CD160, gp49B, PIR-B, family receivers KIR, TIM-1, TIM-3, TIM-4, LAG-3, BTLA, SIRPalfa (CD47), CD48, 2B4 (CD244), B7.1, B7.2, ILT-2, ILT-4 , TIGIT, A2aR, DR3, IDOL, IDO2, LAIR-2, LIGHT, MARCO (macrophage receptor with collagen structure), PS (phosphatidylserine), OX-40, SLAM, TIGHT, VISTA and / or VTCN1. Exemplary agents useful for inhibiting immune checkpoint proteins include antibodies (and antibody fragments, variants or derivatives), peptides, natural ligands (and ligand fragments, variants or derivatives), fusion proteins that can bind directly - to (and thus inactivate or inhibit) indirectly inactivate or inhibit the proteins of the immune checkpoint, for example, binding, inactivating and / or inhibiting their receptors or signaling molecules downstream to block the interaction between one or more more immune checkpoint proteins and their natural receptors and / or to prevent inhibitory signaling mediated by the binding of said immune checkpoint proteins and their natural receptors. Exemplary immune checkpoint inhibitors include A2AR; B7-H3, i.e., cD276; B7-HA4, i.e., VTON1; BTLA; CTLA-A4; IDO, that is, Indoleamine
[00151] [00151] The term "T cell receptor" or "TCR" refers to a specific T cell protein receptor that is composed of a linked hetero-polymer of alpha (a) and beta (B) variable chains a disulfide or gamma and delta (y / 5), optionally forming a complex with domains for additional (co-) stimulatory signaling, such as invariant CD3-zeta (6) and / or FcR, CD27, CD28, 4 chains -1BB (CD137), DAP10 and / or OX40. The term "T cell receptor" includes variants (engineered), fragments and derivatives of these naturally occurring TCRs, including chimeric antigen receptors (CARs). The term "chimeric antigen receptor (CAR)" generally refers to engineered fusion proteins that comprise binding domains fused to an intracellular signaling domain capable of activating T cells. Typically, CARs are chimeric polypeptide constructs comprising at least one extracellular antigen-binding domain, a transmembrane domain and a cytoplasmic signaling domain (also referred to herein as "an intracellular signaling domain") comprising a functional signaling domain derived from a (co) stimulating molecule , such as the CD3-zeta, FcR, CD27, CD28, 4-1BB (CD137), DAP10 and / or OX40 chain. The extracellular antigen-binding domain can typically be derived from a monoclonal antibody or its fragment, variant or derivative. In particular aspects, CARs comprise fusions of single-chain variable fragments (scFv) derived from monoclonal antibodies, fused to the CD3-zeta transmembrane and intracellular endodomain.
[00152] [00152] - Artificial nucleic acid molecules of the invention encoding preferred sequences for the treatment of tumor diseases or cancer may preferably comprise a coding region comprising or consisting of a nucleic acid sequence of according to any of SEQ ID NO: 1 to 10071, preferably SEQ ID NO: 1, 3, 5, 6, 389 or 399, or respectively Tables 1 to 12 or Tables 14 to 17, as described in the patent application international WO2016170176A1, in particular a nucleic acid sequence being identical or with a sequence identity of at least 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86% , 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 80%, with these strings or a fragment or variant of any of these RNA sequences. In this context, the disclosure of WO2016170176A1 is also incorporated herein by reference. The person skilled in the art knows that other (redundant) mRNA sequences can also encode proteins, as shown in the reference above, so mRNA sequences are not limited to them.
[00153] [00153] —Additional artificial nucleic acid molecules of the invention that encode preferred sequences for the treatment of tumor or cancer diseases may preferably comprise a coding region that comprises or consists of a nucleic acid sequence according to with any of SEQ ID NO SEQ ID NO, as shown in international patent applications WO2009046974, WO2015024666, WO2009046739, WO2015024664,
[00154] [00154] The term "enzyme" is well known in the art and refers to chemical (poly) peptide and protein catalysts. Enzymes include intact whole enzyme or fragments, variants or derivatives thereof. Exemplary enzymes include oxidoreductases, transfers, hydrolases, lyases, isomerases and ligases.
[00155] [00155] The fragments, variants and derivatives of the aforementioned therapeutic proteins are also considered as (polypeptides or proteins of interest, as long as they are preferably functional and, therefore, capable of mediating the desired biological effect or function. (Poly) peptides or antigenic proteins
[00156] [00156] At least one coding region of the artificial nucleic acid molecule of the invention can encode at least one "(poly) peptide or antigenic protein". The term "(poly) peptide or antigenic protein" or, succinctly, "antigen", generally refers to any (poly) peptide or protein capable, under appropriate conditions, of interacting with / being recognized by components of the system immunological (such as antibodies or immune cells through their antigen receptors, for example, B cell receptors (BCRs) or T cell receptors (TCRs)), and preferably capable of eliciting an immune (adaptive) response. The term "components of the immune system" preferably refers to immune cells, immune cell receptors and antibodies of the adaptive immune system. The "antigenic peptide or protein" preferably interacts with / is recognized by the components of the immune system through its "epitopes" or "antigenic determinants".
[00157] [00157] The term "epitope" or "antigenic determinant" refers to a part or fragment of an antigenic peptide or protein that is recognized by the immune system. Said fragment can typically comprise from about 5 to about 20 or even more amino acids. Epitopes can be "conformational" (or "discontinuous"), that is, composed of discontinuous sequences of the amino acids of the peptide or antigenic protein from which they are derived, but assembled in the three-dimensional structure of, for example, an MHC complex , or "linear", that is, it consists of a continuous sequence of amino acids from the antigenic peptides or proteins from which they are derived. The term "epitope" generally encompasses "T cell epitopes" (recognized by T cells via their T cell receptors) and "B cell epitopes" (recognized by B cells via their B cell receptors). "B cell epitopes" are typically located on the outer surface of protein or peptide (native) antigens, as defined herein, and may preferably comprise or consist of 5 to 15 amino acids, more preferably between 5 to 12 amino acids, even more preferably between 6 to 9 amino acids. "T cell epitopes" are typically recognized by T cells in the form linked to MHC-I or MHC-II, that is, as a complex formed by an antigenic protein or peptide fragment comprising the epitope and an MHC surface molecule -I or MHC-II. "T cell epitopes" can typically be about 6 to about 20 or even more amino acids long, T cell epitopes presented by MHC class | they may preferably have a length of about 8 to about 10 amino acids, for example 8, 9 or 10 (or even 11 or 12 amino acids). The T cell epitopes presented by the MHC class | they can preferably have a length of about 13 or more amino acids, for example, 13, 14, 15, 16, 17, 18, 19, 20 or even more amino acids. In the context of the present invention, the term "epitope" may, in particular, refer to T cell epitopes.
[00158] [00158] Thus, the term "(poly) peptide or antigenic protein" refers to a (poly) peptide comprising, consisting of or being able to provide at least one (functional) epitope. The artificial nucleic acid (RNA) molecules of the invention can encode (poly) peptides or complete antigenic proteins, or preferably their fragments. Said fragments may comprise or consist of or are capable of providing (functional) epitopes of said (poly) peptides or antigenic proteins. A "functional" epitope refers to an epitope capable of inducing a desired adaptive immune response in an individual.
[00159] [00159] - Artificial nucleic acid (RNA) molecules that encode, in their at least one coding region, at least one (polypeptide or antigenic protein, can enter target cells (for example, professional antigen presenting cells (APCs) ), in which at least one (poly) peptide or antigenic protein is expressed, processed and presented to immune cells (for example, T cells) in an MHC molecule, preferably resulting in a response
[00160] [00160] When referring to an artificial nucleic acid (RNA) molecule that encodes "at least one peptide or antigenic protein" in this invention, it is provided that said artificial nucleic acid (RNA) molecule may encode one or more (poly) peptides or full-length antigenic proteins, or one or more fragments, in particular an (functional) epitope, of said (poly) peptide or antigenic protein. The full length (s) antigenic (poly) peptides or proteins, or fragments thereof, preferably comprise, consist of or are capable of providing at least one (functional) epitope, that is, said (antigenic) peptides or proteins or its fragments preferably comprise or consist of a native epitope (preferably recognized by B cells) or are capable of being processed and presented by an MHC-I or MHC-Il molecule to provide an MHC-linked epitope (preferably recognized by T cells).
[00161] [00161] The choice of specific (poly) peptides or antigenic proteins generally depends on the disease to be treated or prevented. In general, the artificial nucleic acid (RNA) molecule can encode any (poly) peptide or antigenic protein associated with a disease
[00162] [00162] Preferably, the artificial nucleic acid molecules according to the invention can comprise at least one coding region that encodes a tumor antigen, a pathogenic antigen, a autoantigen, an alloantigen or an allergenic antigen.
[00163] [00163] The term "tumor antigen" refers to (poly) peptides or antigenic proteins derived from or associated with a tumor (preferably malignant) or a cancer disease. As used in this invention, the terms "cancer" and "tumor" are used interchangeably to refer to a neoplasm characterized by uncontrolled and generally rapid proliferation of cells that tend to invade the surrounding tissue and metastasize away from the body. The term covers benign and malignant neoplasms. Malignancy in cancers is typically characterized by anaplasia, invasiveness and metastasis; whereas benign malignancies typically have none of these properties. The terms "cancer" and "tumor", in particular, refer to neoplasms characterized by tumor growth, but also to cancers of the blood and lymphatic system. A "tumor antigen" is typically derived from a tumor / cancer cell, preferably a mammalian tumor / cancer cell, and may be located on the surface of a mammalian-derived tumor cell, preferably a human tumor, such as a human tumor. a systemic or solid tumor. "Tumor antigens" generally include tumor-specific antigens (TSAs) and tumor-associated antigens (TAAs). TSAs typically result from a specific tumor mutation and are expressed specifically by tumor cells. TAAs, which are more common, are generally presented by both tumoral and "normal" (healthy, non-tumoral) cells.
[00164] [00164] The protein or polypeptide may comprise or consist of a tumor antigen, a fragment, variant or derivative of a tumor antigen.
[00165] [00165] - Particularly preferred in this context are the tumor antigens NY-ESO-1, 5T4, MAGE-C1, MAGE-C2, Survivina, Muc-1, PSA, PSMA, PSCA, STEAP and PAP, or homologues, fragments, vari - before or derived from any of these tumor antigens.
[001668] [001668] The term "pathogenic antigen" refers to (poly) peptides or antigenic proteins derived from or associated with pathogens, that is, viruses, microorganisms or other substances that cause infection and typically diseases, including, in addition to viruses, bacteria, protozoa or fungi. In particular, these "pathogenic antigens" may be able to elicit an immune response in an individual, preferably a mammalian individual, more preferably a human being. Typically, pathogenic antigens can be surface antigens, for example, (poly) peptides or proteins (or fragments of proteins, for example, the outside of a surface antigen) located on the surface of the pathogen (for example, its capsid, plasma membrane or cell wall).
[00167] [00167] - “Consequently, in some preferred embodiments, the artificial nucleic acid (RNA) molecule can encode at least one region encoding at least one pathogenic antigen selected from a bacterial, viral, fungal or protozoan antigen. The encoded (poly) peptide or protein may consist of or comprise a pathogenic antigen or a fragment, variant or derivative thereof.
[00168] [00168] —Pathogenic antigens may preferably be selected from antigens derived from the pathogens Acinetobacter baumannii, genus Anaplasma, Anaplasma phagocytophilum, Ancylostoma braziliense, Ancylostoma duodenale, Arcanobacterium haemolyticum, Ascaris lumbres, Ascaris lumbrides Bacillus anthracis, Bacillus cereus, Bartonella henselae, BK virus, Blastocystis hominis, Blastomyces dermatitidis, Bordetella pertussis, Borrelia burgdorferi, genus Borrelia, Borrelia spp, Brucella genus,
[00169] [00169] Other preferred pathogenic antigens can be derived
[00170] [00170] Other preferred pathogenic antigens can be derived from Agrobacterium tumefaciens, Ajellomyces dermatitidis ATCC 60636, Alphapapillomavirus 10, Andes orthohantavirus, Andes virus CHI-7913, Aspergillus terreus NIH2624, Hepatitis E bacterium, Bacteria, Bacillus , Betacoronavirus England 1, Blattella germanica, Bordetella pertussis, Borna strain virus Giessen He / 80, Borrelia burgdorferi B31, Borrelia burgdorferi CA12, Borrelia burgdorferi N40, Borrelia burgdorferi ZS7, Borrelia garinni IP90, Borrelia hermsi, Borreliella afelii Borreliella burgdorferi, Bor- reliella garinii, Bos taurus, Brucella melitensis, Brugia malayi, Bundi- bugyo ebolavirus, Burkholderia pseudomallei, Burkholderia pseudomal- lei K96243, Campylobacter jejuni, Campylobacter upsaliensis, Candida albikya Chirus, Viruses and viruses, Cavia 08/065, Chikungunya Virus Singapore / 11/2008, Chikungunya Virus strain LR2006 OPY1 IMT / Reunion Islan d / 2006, Chikungunya strain virus S27-African prototype, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydia trachomatis Serovar D, Chlamydiae, Clostridioides difficile, Clostridium difficile BI / NAP1 / 027, Clostridium tetani, Virus Convictia Creek 107 , smallpox booster virus (Brighton Red) White-pock, Coxsackievirus A16, Coxsackievirus A9, Coxsackievirus B1, Coxsackievirus B2, Coxsackievirus B3, Cox-sackievirus B4, hemorrhagic fever Crimean-Congo ortonairovirus, Cryptosporidium parvum, dye virus dengue virus 1, dengue virus 1 Nauru / West Pac / 1974, dengue virus 1 PVP159, dengue virus 1 Singapore / S275 / 1990, dengue virus 2, Dengue virus 2 D2 / SG / 05K4155DK1 / 2005, dengue 2 Jamaica / 1409/1983, Dengue virus 2 Puerto Rico / PR159-S1 / 1969, Dengue virus 2 strain 43, Dengue virus 2 Thailand / 16681/84, Dengue virus 2 Thailand / NGS-C / 1944, Dengue virus 3, Dengue virus 4, Dengue virus 4 Dominica / 814669/1981, Dengue virus dengue 4 Thailand / 0348/1991, Dengue virus type 1 Hawaii, Ebola - Mayinga virus, Zaire, 1976, Ebolavirus, Echinococcus granulosus, Echinococcus multilocularis, Echovirus E11, Echovirus E9, Ehrlichia canis str.
[00171] [00171] The artificial nucleic acid molecules of the invention encoding the preferred influenza-derived pathogenic antigens can preferably comprise a coding region comprising or consisting of a nucleic acid sequence according to any of SEQ ID NOs as shown in Fig 1, Fig. 2, Fig. 3 or Fig. 4 or respectively Table 1, Table 2, Table 3 or Table 4 of the international patent application PCT / EP2017 / 060663, or a fragment or variant of any of these sequences , in particular a nucleic acid sequence having a sequence identity of at least 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88 %, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 80% with any of these sequences. In this context, the disclosure of PCT / EP2017 / 060663 is hereby incorporated by reference.
[00172] [00172] The artificial nucleic acid molecules of the invention which encode other preferred pathogenic antigens derived from the influence can preferably comprise a coding region which comprises or consists of a nucleic acid sequence according to any of the SEQ ID NOs as shown in Fig. 20, Fig. 21, Fig. 22, or Fig. 23 or respectively Table 1, Table 2, Table 3 or Table 4 of the international patent application PCT / EP2017 / 064066, or a fragment or variant of any of these sequences, in particular a nucleic acid sequence having a sequence identity of at least 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 80% with any of these sequences. In this context, the disclosure of POCT / EP2017 / 064066 is hereby incorporated by reference.
[00173] [00173] The artificial nucleic acid molecules of the invention encoding preferred rabies virus-derived pathogenic antigens can preferably comprise a coding region comprising or consisting of a nucleic acid sequence according to SEQ ID NO: 24 or SEQ ID NO: 25 of international patent application WO 2015/024665 A1, or a fragment or variant of any of these sequences, in particular a nucleic acid sequence having a sequence identity of at least 50%, 60%, 70%, 80 %, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 80% with any of these sequences. In this context, the disclosure of WO 2015/024665 A1 is incorporated herein by reference.
[00174] [00174] The artificial nucleic acid molecules of the invention that encode other preferred pathogenic antigens derived from the rabies virus may preferably comprise a coding region that comprises or consists of a nucleic acid sequence according to SEQ ID NO: 24 or Table 5 of the international patent application POT / EP2017 / 064066, or a fragment or variant of any of these sequences, in particular a nucleic acid sequence having a sequence identity of at least 50%, 60%, 70%, 80 %, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 80% with any of these sequences. In this context, the disclosure of POCT / EP2017 / 064066is incorporated herein by reference.
[00175] [00175] The artificial nucleic acid molecules of the invention that encode preferred RSV-derived pathogenic antigens may preferably comprise a coding region that comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 31 to 35 of the international patent application WO 2015/024668 A2, or a fragment or variant of any of these sequences, in particular a nucleic acid sequence having a sequence identity of at least 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96% , 97%, 98% or 99%,
[00176] [00176] The artificial nucleic acid molecules of the invention which encode preferred pathogenic antigens derived from Ebola or Marburgvirus can preferably comprise a coding region comprising or consisting of a nucleic acid sequence according to any of SEQ ID NOs: 20 to 233 of international patent application WO 2016/097065 A1, or a fragment or variant of any of these sequences, in particular a nucleic acid sequence having a sequence identity of at least 50%, 60%, 70% , 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96 %, 97%, 98% or 99%, preferably at least 80% with any of these sequences. In this context, the disclosure of WO 2016/097065 A1 is hereby incorporated by reference.
[00177] [00177] The artificial nucleic acid molecules of the invention that encode preferred pathogenic antigens derived from the Zika virus can preferably comprise a coding region that comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 1 to 11759 or Table 1, Table 1A, Table 2, Table 2A, Table 3, Table 3A, Table 4, Table 4A, Table 5, Table 5A, Table 6, Table 6A, Table 7, Table 8, or Table 14 international patent application WO 2017/140905 A1, or a fragment or variant of any of these sequences, in particular a nucleic acid sequence having a sequence identity of at least 50%, 60%, 70%, 80%, 81% , 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 % or 99%, preferably at least 80% with any of these strings. In this context, the disclosure of WO
[00178] [00178] The artificial nucleic acid molecules of the invention that encode the preferred pathogenic antigens derived from Norovirus may preferably comprise a coding region that comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 1 to 39746 or Table 1 of the international patent application POT / EP2017 / 060673, or a fragment or variant of any of these sequences, in particular a nucleic acid sequence having a sequence identity of at least 50%, 60%, 70% , 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96 %, 97%, 98% or 99%, preferably at least 80% with any of these sequences. In this context, the disclosure of POCT / EP2017 / 060673 is hereby incorporated by reference.
[00179] [00179] The artificial nucleic acid molecules of the invention that encode the preferred pathogenic antigens derived from Rotavirus may preferably comprise a coding region that comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 1 to 3593 or Tables 1 a of the international patent application WO 2017/081110 A1, or a fragment or variant of any of these sequences, in particular a nucleic acid sequence having a sequence identity of at least 50%, 60% , 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98% or 99%, preferably at least 80% with any of these sequences. In this context, the disclosure of WO 2017/081110 A1 is hereby incorporated by reference.
[00180] [00180] The term "autoantigen" refers to an "own" endogenous antigen that - despite being a normal constituent of the body - induces an autoimmune reaction in the host. In the context of the present invention
[00181] [00181] The term "alloantigen" (also known as "allogeneic antigen" or "isoantigen") refers to an antigen existing in alternative (allelic) forms in a species and therefore can induce alloimmunity (or isoimmunity) in members of the same species, for example, after blood transfusion, tissue or organ transplantation Or, sometimes, pregnancy. Typical allogeneic antigens include histocompatibility antigens and blood group antigens. In the context of the present invention, alloantigens are preferably of human origin. Artificial nucleic acid (RNA) molecules encoding (poly) peptides or antigenic proteins derived from alloantigens can, for example, be used to induce immunological tolerance to said alloantigen.
[00182] [00182] Examples of allogeneic antigens in the context of the present invention include, without limitation, allogeneic antigens derived from or selected from the precursor UDP-glucuronosyltransferase 2B17, antigen MHC class | HLA-A2, precursor to coagulation factor VIII, coagulation factor VIII, precursor to thrombopoietin (megakaryocyte colony stimulating factor) (myeloproliferative leukemia virus oncogene ligand) (C-mpl ligand) (ML) (growth factor and development of megakaryocytes) (MGDF), integrin beta-3, histocompatibility (minor) HA-1, SMCY, thymosin beta-4, Y chromosome, Histone demethylase UTY, histocompatibility antigen HLA class | l, beta chain DP (W2), lysine-specific 5D demethylase isoform 1, myosin-lg, probable carboxyl-terminal ubiquitin hydrolase FAF-Y, pro-cathepsin H, DRB1, variant MHC DR beta DRw13, HLA histocompatibility antigen class Il, beta chain DRB1-15, histocompatibility antigen HLA class | l, precursor of beta chain DRB1-1, HMSD variant form of the minor histocompatibility protein, HLA-DR3, chain B, Human Histocompatibility Protein Class Il Hla-Dr1i (Dra, Drb1 0101) (Extracellular Domain) Comp linked to Endogenous Peptide, MHC class | l HLA-DRB1, MHC class | HLA-A, human leukocyte antigen B, activator of RAS type-3 protein, year
[00183] [00183] At least one coding region of the artificial nucleic acid molecule of the invention can encode at least one "(poly) peptide or allergenic protein". The term "(poly) peptide or allergenic protein" or "allergen" refers to (poly) peptides or proteins capable of inducing an allergic reaction, that is, a pathological immune reaction characterized by a body reactivity altered (such as hypersensitivity) after exposure to an individual. Typically, "allergens" are implicated in "atopy", that is, adverse immunological reactions involving immunoglobulin E (IgE). The term "allergen" typically means a substance (here: a (polypeptide or protein) that is involved in atopy and induces IgE antibodies. Typical allergens provided for here include protein allergens derived from Crustacea, allergens derived from insects , mammalian allergens, shellfish-derived allergens, plant allergens and fungal allergens.
[00184] [00184] “Examples of allergens in the context of the present invention include, without limitation, allergens derived or selected from Allergen Pen n 18, Antigen Name, allergen Ara h 2.01, melanoma antigen recognized by T 1 cells, a nonspecific precursor of lipid transfer protein (LTP) (Mal d 3 allergen), ovalbumin
[00185] [00185] The at least one coding region of the artificial nucleic acid (RNA) molecule of the invention can encode at least one "(poly) peptide or reporter protein".
[00186] [00186] The term "(poly) peptide or reporter protein" refers to a (poly) peptide or protein that is expressed from a reporter gene. The (poly) peptides or reporter proteins are typically heterologous to the expression system used. Their presence and / or functionality can preferably be easily detected, visualized and / or measured (for example, by fluorescence, spectroscopy, luminometry, etc.).
[00187] [00187] Os (exemplary polypeptides or reporter proteins included in beta-galactosidase (encoded by the bacterial lacZ gene); luciferase; chloramphenyl acetyltransferase (CAT); GUS (beta-glucuronidase); alkaline phosphatase; green fluorescent protein (GFP) and its variants and derivatives, such as enhanced fluorescent green proteins (eGFP), CFP, YFP, GFP +; alkaline phosphatase or segregated alkaline phosphatase; peroxidase, beta-xylosidase; XylE (catechol dioxigenase); TreA (trehalase); Discosoma sp red fluorescent protein (dsRED) and its variants and derivatives, such as mCherry; HcRed; AmCyan; ZsGreen; ZsYellow; AsRed; and other bioluminescent and fluorescent proteins. The term "luciferase" refers to a class of oxidative enzymes that are capable of producing bioluminescence. Many luciferases are known in the art, for example, firefly luciferase (for example, Photinus pyralis firefly), Renilla luciferase (Renilla reniformis), Metridia luciferase (MetLuc, derived from the marine copepod Metridia longa), Aequorea luciferase, Dinoflagellate luciferase or Gaussia luciferase (Gluc) or an isoform, homolog, fragment, variant or derivative of any of these proteins. Domains, labels, ligands, sequences or additional elements
[00188] [00188] At least one coding region of the artificial nucleic acid molecule of the invention can encode, preferably in addition to at least one (poly) peptide or protein of interest, other domains, markers, ligands, sequences or elements of (polypeptides. The nucleic acid sequences encoding said domains, markers, ligands, sequences or additional elements are expected to be operably linked in the structure to the region encoding the (poly) peptide or protein of interest, so that the expression of the coding sequence preferably produces a fusion product (or: derivative) of the (poly) peptide or protein of interest coupled to the domains, labels, ligands, sequences or additional elements.
[00189] [00189] For example, nucleic acid sequences encoding other (poly) peptide domains, markers, ligands, sequences or elements are preferably framed with the nucleic acid sequence encoding the (poly) peptide or protein of interest. The use of codons can be adapted to the host intended to express the artificial nucleic acid (RNA) molecule of the invention.
[00190] [00190] Preferably, the at least one coding region of the artificial nucleic acid molecule of the invention can further encode at least one (a) effector domain; (b) peptide or protein marker; (c) location signal or sequence; (d) nuclear location signal (NLS); (e) signal peptide; (f) peptide linker; (g) signal secreting peptide (SSP), (h) multimerization element including dimerization, trimerization, tetramerization or oligomerization elements; (i) virus-like particle-forming element (VLP); (j) transmembrane element; (k) dendritic cell targeting element; (1) immunological adjuvant element; (m) element that promotes the presentation of the antigen; (n) 2A peptide; (o) element that prolongs the half-life of the protein; and / or (p) element for post-translational modification (eg glycosylation). Effector domains
[00191] [00191] The term "effector domain" refers to (poly) peptides or protein domains that confer biological effector functions, typically interacting with a target, for example, enzymatic activity, binding to the target (for example, ligand, receptor, protein, nucleic acid, hormone, small organic molecule of the neurotransmitter), signal transduction, immunostimulation and the like.
[00192] [00192] Effector domains can be suitably (additionally) encoded by artificial nucleic acid (RNA) molecules that encode any (poly) peptide or protein of interest, as disclosed in this invention. The effector domains fused or inserted into (poly) peptides or proteins of interest can advantageously confer an additional biological function or activity to said (poly) peptide or protein. When encoded in combination with a (poly) peptide or protein of interest, the effector domains can be placed at the N-terminal, C-terminal and / or within the (poly) peptide or protein of interest or combinations thereof. Different effector domains can be combined. At the nucleic acid level, the
[00193] [00193] "Peptide or protein markers" are short sequences of amino acid introduced into (poly) peptides or proteins of interest to confer a desired biological functionality or property. Typically, "peptide markers" can be used to detect, purify, separate or add certain desired biological properties or functionalities.
[00194] [00194] The peptide or protein markers can therefore be implanted for different purposes. Almost all peptide markers can be used to allow the detection of a (poly) peptide or protein of interest by Western blot, ELISA, ChIP, immunocytochemistry, immunohistochemistry and fluorescence measurement. Most protein or peptide markers can be used to purify (poly) peptides or proteins of interest. Some markers can be explored to extend the biological protein half-life, or to increase the solubility of (poly) peptides and proteins of interest, or to help locate a (poly) peptide or protein in a cell compartment.
[00195] [00195] Protein or peptide markers can be appropriately (additionally) encoded by artificial nucleic acid (RNA) molecules that encode any (poly) peptide or protein of interest, as disclosed herein. Protein or peptide labels fused or inserted into (poly) peptides or proteins of interest can advantageously allow, for example, the detection, purification or separation of said (poly) peptide or protein. When encoded in combination with a (poly) peptide or protein of interest, protein or peptide markers can be placed at the N-terminal, C-terminal and / or within the (poly) peptide or protein of interest, or their combinations. Different protein or peptide markers can be combined. Protein or peptide markers can be repeated and, for example, expressed in tan or triplet. At the nucleic acid level, the coding sequence for those protein or peptide markers is typically placed in the structure (i.e., in the same reading frame), 3 'in, 5' in or within the ( poly) peptide or protein of interest or combinations thereof.
[00196] [00196] Protein and peptide markers can be classified based on their (primary) function. Exemplary protein and peptide markers envisaged in the context of the present invention include, without limitation, markers selected from the following groups. Affinity markers allow purification of (polypeptides or proteins of interest and include, without limitation, chitin-binding protein (CBP), maltose-binding protein (MBP), Strep marker, glutathione-S-transferase (GST) and poly (His) markers typically comprising six tandem histidine residues that form a nickel-binding structure.The solubilization markers assist in proper folding and prevent the precipitation of (poly) peptides or proteins of interest and include thioredoxin (TRX) and poly (NANP). MBP and GST markers can also be used as solubilization markers. Chromatography markers alter the chromatographic properties of proteins or (polypeptides of interest and allow their separation chromatographic techniques. Typically, chromatography markers consist of polyanionic amino acids, such as the FLAG marker (which can typically comprise the amino acid sequence N-DYKDDDDK-C ( SEQ ID NO: 378). Epitopic markers are peptide sequences
[00197] [00197] A "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence capable of targeting a (poly) peptide or protein of interest to the nucleus - in other words, a nuclear location signal "markers" of (polypeptide or protein of interest for nuclear import. Generally, proteins gain entry into the nucleus through the nuclear envelope. The nuclear envelope consists of concentric membranes, the outer and inner membranes. The inner and outer membranes connect at various sites, forming channels between the cytoplasm and the nucleleoplasm.These channels are occupied by nuclear pore complexes (NPCs), complex multiprotein structures that act as mediators of transport across the nuclear membrane. .
[00198] [00198] Nuclear localization signals can be suitably (additionally) encoded by artificial nucleic acid (RNA) molecules that encode any (poly) peptide or protein of interest, as disclosed in this invention. Nuclear localization signals fused or inserted into (poly) peptides or proteins of interest can advantageously promote binding to importin (also known as karyopherin) and / or nuclear import of said (polypeptide or protein. Without wishing to be bound According to a specific theory, NLS can be particularly useful when fused or inserted into therapeutic (poly) peptides or proteins that are intended for nuclear targeting, for example, gene editing agents, inducers or repressors of transcription. However, an NLS can be encoded with any other (poly) peptide or protein also disclosed herein.When encoded in combination with a (poly) peptide or protein of interest, these nuclear localization signals can be placed at the N-terminus, C- terminal and / or inside the
[00199] [00199] Typically, an "NLS" may comprise or consist of one or more short sequences of positively charged lysines or arginines, which are preferably exposed on the surface of the protein. A variety of NLS sequences are known in the art. Exemplary NLS sequences that can be selected for use with the present invention include, without limitation, the following. The best characterized transport signal is the classic NLS (cCNLS) for importing nuclear proteins, which consists of a stretch (mono-party) or two stretches (bipartite) of basic amino acids. Typically, the monopartite motif is characterized by a set of basic residues preceded by a helix break residue. Likewise, the bipartite motif consists of two groups of basic residues separated by 9 to 12 residues. Monopartite cNLSs are exemplified by the SV40 NLS large T antigen (PEPKKKRRVV2 (SEQ ID NO: 381) and bipartite cNLSs are exemplified by the nucleosplasm NLS (** KRPAATKKAGQAKKKK7º (SEQ ID NO: 382). terminal of the monopartite NLS are referred to as P1, P2, etc. The monopartite cNLS typically requires a lysine at the P1 position, followed by basic residues at the P2 and P4 positions to produce a K free consensus sequence (KR) X (K / R) (SEQ ID NO: 384) (Lange et al. J Biol Chem. 2007 Feb 23; 282 (8): 5101-5105).
[00200] [00200] The term "signal peptide" (sometimes called a secretory signal peptide or SSP, signal sequence, leader sequence or leader peptide) refers to a typically short peptide (usually 16 to 30 amino acids) which is usually present in the N-terminal of newly synthesized proteins destined for the secretory pathway. These proteins include those that reside within certain organelles (endoplasmic reticulum, golgi or endosomes), secreted by the cell or inserted into most cell membranes. In eukaryotic cells, signal peptides are typically cleaved from the polypeptide chain birth immediately after their translocation into the endoplasmic reticulum membrane. Translocation occurs cotranslationally and depends on a protein-RNA cytoplasmic complex (signal recognition particle, SRP). Protein folding and certain post-translational modifications (eg, glycosylation) typically occur within the ER. Subsequently, the protein is typically transported to the Golgi vesicles and secreted.
[00201] [00201] Signal peptides can be suitably (additionally) encoded by artificial nucleic acid (RNA) molecules that encode any (poly) peptide or protein of interest, as disclosed herein. The signal peptides fused or inserted in (polypeptides or proteins of interest) can advantageously act as a mediator of the transport of said (poly) peptide or protein of interest to a defined cell compartment, for example, the cell surface, the reticulum endoplasmic (ER) or endosomal-lysosomal compartment, preferably signal peptides can be introduced into the (poly) peptide or protein of interest to promote the secretion of said (poly) peptides or proteins. of artificial nucleic acids that encode (polypeptides or antigenic proteins are fused to a signal peptide, adequate secretion can assist in triggering an immune response against that antigen, since its release and distribution preferably mimic a viral infection that occurs naturally. - generally and ensures that professional antigen presenting cells (APCs) are exposed to the encoded antigens. However, signal peptides can be usefully combined with any other (poly) peptide or protein disclosed herein. When encoded in combination with a (poly) peptide or protein of interest, these signal peptides can be placed at the N-terminal, C-terminal and / or within the (poly) peptide or protein of interest, preferably on your N-terminal. At the nucleic acid level, the coding sequence for that signal peptide is typically placed in the structure (i.e., in the same reading frame), 5 'or 3' or within the coding sequence for the (poly) peptide or protein of interest or their combinations, preferably 3 'to said coding sequence.
[00202] [00202] Signal peptides can typically have a tripartite structure, consisting of a central hydrophobic region flanked by an n and c region. Typically, region n is one to five amino acids in length and mainly comprises positively charged amino acids. Region c, which is located between the central hydrophobic region and the signal peptidase cleavage site, typically consists of three to seven polar amino acids, but mostly uncharged. A specific pattern of amino acids (in accordance with the so-called "rule (3.1)") is found close to the cleavage site: the amino acid residues at positions 3 and 1 (in relation to the cleavage site) are typically small and neutral.
[00203] [00203] Exemplary signal peptides provided for in the context of the present invention include, but are not limited to, signal sequences of classical or non-classical MHC molecules (e.g., signal sequences of MHC | and Il molecules, for example, of the MHC molecule class | HLA-A * 0201), cytokine or immunoglobulin signal sequences, immunoglobulin or antibody invariant chain signal sequences, Lamp1, Tapasin, Erp57, Calretikulin signal sequences , Calnexin, PLAT, EPO or albumin and other proteins associated with the membrane or proteins associated with the endoplasmic reticulum (ER) or endosomal-lysosomal compartment. More preferably, the signal sequences can be derived from HLA-A2 (human), PLAT (human), SEPO (human), ALB (human) ALB, IgE-leader (human), CD5 (human), IL2 ( human), CTRB2 (human), I9gG-HC (human), Ig-HC (human), Ig-LC, GpLuc (human), Igkappa (human) or a fragment or variant of any of the proteins mentioned above, in particular HLA-A2, HsPLAT, sHsEPO, HsALB, HsPLAT (aa1-21),) HsPLAT (aa1-22), IgE-leader, HsCD5 (aa1-24), HslL2 (aa1-20), HSCTRB2 (aa1-18) ), IgG-HC (aa1-19), Ig-HC (aa1-19), Ig-LC (aa1-19), GpLuc (1-17) or Mmlgkappa.
[00204] [00204] The particular signal peptides and nucleic acid sequences encoding them intended for use in the present invention are, among others, disclosed in WO 2017/081082 A2, which is incorporated herein by reference in its entirety. Peptide ligands
[00205] [00205] A "peptide linker" or "spacer" is a short sequence of amino acids that unites domains, portions or parts of (polypeptides or proteins of interest, as disclosed in this invention, for example, multi-domain proteins or fusion proteins The (poly) peptides or proteins, or their domains, portions or parts are preferably functional, that is, they fulfill a specific biological function.
[00206] [00206] Peptide ligands can be suitably (added
[00207] [00207] Peptide linkers are typically short (comprising from 1 to 150 amino acids, preferably from 1 to 50 amino acids, more preferably from 1 to 20 amino acids) and can preferably be composed of small, non-polar (e.g. Gly) or polar (for example, Ser or Thr). Peptide ligands are generally known in the art and can be classified into three types: flexible ligands, rigid ligands and cleavable ligands. Flexible ligands are generally applied when the joined (poly) peptides or proteins, or their domains, portions or parts, require a certain degree of movement, flexibility and / or interaction. Flexible ligands are generally rich in small, non-polar (for example, Gly) or polar (for example, Ser or Thr) amino acids to provide good flexibility and solubility, in addition to supporting the mobility of (polypeptides or proteins, or their domains, portions or parts The sequences of the exemplary flexible linkage branches typically contain about 4 to about 10 glycine residues.The incorporation of Ser or Thr can maintain the stability of the binder in aqueous solutions through the formation of hydrogen bonds with water molecules and therefore reduces unfavorable interactions between the ligand and protein components.
[00208] [00208] The most commonly used flexible ligands have sequences that consist mainly of stretches of Gly and Ser residues ("GS" ligand). For example, the linker can have the following sequence: GS, GSG, SGG, SG, GGS, SGS, GSS and SSG. The same sequence can be repeated several times (for example, two, three, four, five or six times) to create a longer link. It is also conceivable to introduce a single amino acid residue such as S or G as a peptide linker. An example of the most widely used flexible binder has the sequence of (G-G-G-G-S), (SEQ ID NO: 383). By adjusting the number of copies "n", the length of this GS linker can be optimized to obtain the appropriate separation and / or flexibility of the joined (poly) peptides or proteins, or their domains, portions or parts, or to maintain the necessary cross-domain interactions. In addition to the GS binders, many other flexible binders are known in the art. These flexible ligands are also rich in small or polar amino acids, such as Gly and Ser, but may contain additional amino acids, such as Thr and Ala, to maintain flexibility, as well as polar amino acids, such as Lys and Glu, to improve solubility. Rigid ligands can be used to guarantee the separation of the joined (poly) peptides or proteins, or their domains, portions or parts and to reduce interference or stereo impediment. Cleavable linkers, on the other hand, can be introduced to release free (poly) peptides or functional proteins, or their domains, portions or parts in vivo. For example, cleavable linkers can be Arg-Arg or Lys-Lys which are sensitive to cleavage with an enzyme such as cathepsin or trypsin. Peptide ligands may or may not be non-immunogenic (that is, capable of eliciting an immune response). Chen et al. Adv Drug Deliv Rev. 2013 Oct 15; 65 (10): 1357-1369 reviews the most commonly used peptide ligands and their applications, and is incorporated herein by reference in its entirety. Particular peptide linkers of interest and the nucleic acid sequences encoding them are disclosed, among others, in WO 2017/081082 A2, - WO 2017 / WO 2002/014478 A2, - WO 2001/008636 A2, WO 2013/171505 A2 , WO 2008/017517 A1 and WO 1997/047648 A1, which are also incorporated by reference in their entirety.
[00209] [00209] The term "multimerization element" or "multimeterization domain" refers to (poly) peptides or proteins capable of inducing or promoting the multimerization of (poly) peptides or proteins of interest. The term includes elements of oligomerization, elements of tetramerization, elements of trimerization or elements of dimerization.
[00210] [00210] The multimerization elements can, for example, be adequately (additionally) encoded by artificial nucleic acid (RNA) molecules that encode (poly) peptides or antigenic proteins. The multimerization elements inserted or fused with antigenic (poly) peptides or proteins of interest can advantageously act as a mediator in the formation of complexes of multimeric antigens or antigenic nanoparticles, which are preferably capable of inducing, promoting or potentiating immune responses to said antigen. In this way, the multimerization elements can be used to mimic a "natural" infection with a pathogen (for example, virus) presenting a plurality of antigens adjacent to each other (for example, hemagglutinin antigen (HA) of the influenza virus ). However, the multimerization elements can be useful in combination with any other (poly) peptide or protein of interest. When encoded in combination with a (poly) peptide or protein of interest, this multimerization element can be placed in its N-Terminal, or in its C-Terminal, or both. At the nucleic acid level, the coding sequence for that multimerization element is typically placed in the structure (i.e., in the same reading frame), 5 'or 3' in the coding sequence for O (poly) peptide or protein of interest.
[00211] [00211] “When used in combination with a polypeptide or protein of interest in the context of the present invention, that multimerization element can be placed at the N-terminal, C-terminal and / or inside the (poly) peptide or protein of interest. At the nucleic acid level, the coding sequence for that multimerization element is typically placed in the structure (i.e., in the same reading frame), 5 'or 3' in the polypeptide or protein coding sequence of interest.
[00212] [00212] Exemplary dimerization elements can be selected from, for example, elements / domains of heat shock protein dimerization, immunoglobulin Fc domains and leucine zippers (dimerization domains of the leucine zipper class of re - basic region of transcription factors). Exemplary trimerization and tetramerization elements can be selected from, for example, manipulated leucine zippers (designed helical wound coil peptide that adopts a parallel trimeric state), fibritin folding domain of enterobacteria phage T4, GCN4pll, CON4 -pLI and p53. Exemplary oligomerization elements can be selected from, for example, ferritin, D surfactant, paramyxovirus phosphoprotein oligomerization domains, C4 inhibitor binding protein oligomerization domains (C4bp), oli domain - gomerization of the viral infectivity factor (Vif), domain of the sterile alpha motif (SAM) and type D domain of the von Wilebrand factor.
[00213] [00213] Ferritin forms oligomers and is a highly conserved protein found in all animals, bacteria and plants. Ferritin is a protein that spontaneously forms nanoparticles of 24 identical subunits. Ferritin-antigen fusion constructs potentially form oligomeric aggregates or "clusters" of antigens that can improve the immune response. Surfactant protein D (SPD) is a hydrophilic glycoprotein that assembles spontaneously to form oligomers. An SPD-antigen fusion construct can form oligomeric aggregates or "clusters" of antigens that can improve the immune response. The phosphoprotein of paramyxoviruses (negative sense RNA virus) functions as a transcriptional transactivator of viral polymerase. Phosphoprotein oligomerization is critical for replication of the viral genome. Phosphoprotein-antigen fusion constructs can form oligomeric aggregates or "clusters" of antigens that can improve the immune response. The complement inhibitor C4-binding protein (C4bp) can also be used as a fusion partner to generate aggregates of oligomeric antigens. The C-terminal C4bp domain (57 amino acid residues in humans and 54 amino acid residues in mice) is necessary and sufficient for the oligomerization of C4bp or other polypeptides fused to it. The C4bp-antigen fusion constructs can form oligomeric aggregates or "clusters" of antigens that can improve the immune response. The multimerization domain of the viral infectivity factor (Vif) has been shown to form oligomers in vitro and in vivo. The oligomerization of Vif involves a sequence mapping between residues 151 to 164 in the C-terminal domain, the 161 PPLP 164 motif (for human HIV-1, TPKKIKPPLP). Vif-antigen fusion constructs can form oligomeric aggregates or "clusters" of antigens that can improve the immune response.
[00214] [00214] The sterile alpha motif domain (SAM) is a protein interaction module present in a wide variety of proteins involved in many biological processes. The SAM domain that spans about 70 residues is found in several eukaryotic organisms. The homo and hetero-oligomerized SAM domains have been shown to form multiple self-associating oligomeric architectures. SAM-antigen fusion constructs can form oligomeric aggregates or "clusters" of antigens that can improve the immune response. The von Willebrand factor (vWWF) contains several domains of type D: D1 and D2 are present in the N-terminal propeptide, while the other D domains are necessary for oligomerization. The vuWF domain is found in several plasma proteins: complementary factors B, C2, C3 and CRA4; integrins (domains |); collagen types VI, VII, XII and XIV; and other extracellular proteins. A vWF-antigen fusion construct can form oligomeric aggregates or "clusters" of antigens that can improve the immune response.
[00215] [00215] Particular multimerization elements and nucleic acid sequences encoding them intended for use in the present invention are, inter alia, disclosed in WO 2017/081082 A2, which is incorporated herein by reference in its entirety. Virus-like particle-forming element
[00216] [00216] The term "virus-like particle-forming element" or "VLP-forming element" refers to (poly) peptides or proteins capable of grouping into non-replicating and / or non-infectious virus-like particles that structurally resemble a virus particle. VLPs are essentially devoid of an infectious and / or replicative viral genome or genome function. Normally, a VLP does not have all or part of the components
[00217] [00217] VLP-forming elements are typically structural viral or phage proteins (ie, envelope proteins or capsid proteins) that preferably comprise repetitive high-density presentations of antigens that form conformational epitopes that can elicit strong adaptive immune responses.
[00218] [00218] The VLP-forming elements can, for example, be adequately (additionally) encoded by artificial nucleic acid (RNA) molecules that encode (poly) peptides or antigenic proteins, but can, however, also be combined usefully with any other (poly) peptide or protein of interest. Elements of VLP formation inserted or fused with (poly) peptides or proteins of interest can, for example, be used to promote or improve the clustering of antigens and the immunogenicity of an (poly) peptide or antigenic protein of interest. stop. When encoded in combination with a (poly) peptide or protein of interest, that VLP-forming element can be placed at the N-terminal, C-terminal and / or within the (poly) peptide or proteins of interest. At the nucleic acid level, the coding sequence for that VLP-forming element is typically placed in the structure (i.e., in the same reading frame), 5 'in, 3' in or within the coding sequence of the (poly) peptide or protein of interest.
[00219] [00219] “Examples of VLP-forming elements can be derived from RNA bacteriophages, bacteriophages, hepatitis B virus (HBV), preferably their capsid protein or envelope protein, measles virus, Sindbis virus, rotavirus, foot-and-mouth virus, Norwalk virus, Alfavirus, retrovirus, preferably its GAG protein, retrotransposon Ty, preferably the pi protein, human papilloma virus
[00220] [00220] "Transmembrane elements" or "membrane-spanning polypeptide elements" (also referred to as "transmembrane domains" or "TM") are present in proteins that are integrated into or anchored in cellular plasma membranes. The transmembrane elements therefore preferably comprise or consist of a sequence of amino acid residues capable of extending and thereby preferably anchoring a (poly) peptide or protein fused to a phospholipid membrane. A transmembrane element can comprise at least about 15 amino acid residues, preferably at least 18, 20, 22, 24, 25, 30, 35 or 40 amino acid residues. The typical transmembrane elements are about 20 + 5 amino acids in length. The amino acid residues that constitute the transmembrane element are preferably selected from non-polar amino acids, mainly hydrophobic. Preferably, at least 50%, 60%, 70%, 80%, 90%, 95% or more of the amino acids of a trans-membrane element can be hydrophobic, for example, leucines, isoleucines, tyrosines or tryptophanes. Transmembrane elements may include, in particular, a series of conserved residues of serine, threonine and tyrosine. Typical transmembrane elements are alpha helical transmembrane elements. The elements of the transmembrane may comprise unique hydrophobic alpha propellers or beta barrel structures; although hydrophobic alpha helices are usually present in proteins present in proteins anchored in the membrane (for example, seven receptors in the transmembrane domain), beta barrel structures are often present in proteins that generate pores or channels.
[00221] [00221] Transmembrane elements can, for example, be adequately (additionally) encoded by artificial nucleic acid (RNA) molecules that encode (poly) peptides or antigenic proteins, but can nevertheless be usefully combined with any other (poly) peptide or protein of interest equally. TM elements fused or inserted into (poly) peptides or proteins of interest can advantageously anchor said (poly) peptide or protein to the cell's plasma membrane. In the case of (polypeptides or antigenic proteins, this anchoring can promote the grouping of antigens, preferably resulting in enhanced immune responses. However, the MT elements can be combined with any other (poly) peptide or protein. In combination with a (poly) peptide or protein of interest, this transmembrane element can be placed at the N-terminal, C-terminal and / or inside the (poly) peptide or protein of interest. , the coding sequence for this transmembrane element is typically placed in the structure (i.e., in the same reading frame), 5 'in, 3' or within the coding sequence for the (poly) peptide or protein of interest.
[00222] [00222] Exemplary transmembrane elements can be selected from the transmembrane domain of influenza virus Hemagglutinin (HA), HIV-1 Env, EIAV (equine infectious anemia virus), MLV (murine leukemia virus) , mouse breast tumor virus, VSV G protein (vesicular stomatitis virus), rabies virus, or a transmembrane element of a seven-transmembrane domain receptor. Particular transmembrane elements and nucleic acid sequences encoding them intended for use in the present invention are, inter alia, disclosed in WO 2017/081082 A2, which is incorporated herein by reference in its entirety. Dendritic cell targeting elements
[00223] [00223] The term "dendritic cell targeting element" refers to a (poly) peptide or protein capable of targeting dendritic cells (CD). Dendritic cells (DCs), the most potent antigen presenting cells (APCs), link the innate immune response to the adaptive immune response. They bind and internalize pathogens / antigens and present fragments of the antigen on their membrane (through MHC molecules) to stimulate T cell responses against these pathogens / antigens.
[00224] [00224] The targeting elements of dendritic cells can, for example, be adequately (additionally) encoded by artificial nucleic acid (RNA) molecules that encode (polypeptides or antigenic proteins, to target antigens to DCs, in order to stimulate and induce effective immune responses, however, dendritic cell targeting elements may be useful in combination with any other (poly) peptide or protein of interest When used in combination with a polypeptide or protein of interest in the context of the present invention , this target element of the dendritic cell can be placed at the N-terminal, C-terminal and / or inside the (poly) peptide or protein of interest. At the nucleic acid level, the coding sequence for this cell element dendritic is typically placed in the structure (that is, in the same reading frame), 5 'or 3' in the coding sequence of the (polypeptide or protein of interest).
[00225] [00225] The targeting elements of dendritic cells include (poly) peptides and proteins (for example, fragments of anti-
[00226] [00226] Examples of derelict cell targeting elements can be selected from anti-DC-SIGN antibodies, CD1.1 c (scFv) specific single chain fragments, DEC205 specific (scFv) single chain fragments , Soluble PD-1, chemokine XCL1 linker (motif C), CD40 linker, human IgG1, murine IgG2a, antiCelec 9A, antiMHCII scFv. Particular elements of targeting dendritic cells and nucleic acid sequences encoding them intended for use in the present invention are, inter alia, disclosed in WO 2017/081082 A2, as well as in Apostolopoulos et al. J Drug Deliv. 2013; 2013: 869718 and Kastenmúller et al. Nat Rev Immunol. 2014 Oct; 14 (10): 705-11, all of which are incorporated by reference in their entirety into this invention. Immune adjuvant element
[00227] [00227] The term "immunological adjuvant elements", or "adjuvant elements", refers to (poly) peptides or proteins that enhance the immune response, for example, by activating a hazard response. (for example, damage-associated molecular pattern molecules (DAMPs)), activation of the complement system (for example, peptides / proteins involved in the classic complement pathway, the complement complement pathway and the lectin pathway) or activating an innate immune response (for example, molecular pattern molecules
[00228] [00228] The immunological adjuvant elements can, for example, be adequately (additionally) encoded by artificial nucleic acid (RNA) molecules that encode (poly) peptides or antigenic proteins, to enhance the immune responses to antigens coded. However, the immunological adjuvant elements can be usefully combined with any other (poly) peptide or protein of interest as well. When used in combination with a polypeptide or protein of interest in the context of the present invention, immunological adjuvant elements can be placed at the N-terminal, C-terminal and / or within the (poly) peptide or protein of interest. At the nucleic acid level, the coding sequence for that immune adjuvant element is typically placed in the structure (that is, in the same reading frame), 5 'n, 3' in or within the coding sequence of ( poly) peptide or protein of interest.
[00229] [00229] “Exemplary immunological adjuvant elements can be selected from heat shock proteins (eg HSP60, HSP70, gp96), flagellin FIiC, high mobility group 1 box proteins (eg HMGN1), extra domain A fibronectin (EDA), C3 protein fragments (for example C3d), transferrin, B-defensin or any other PAMP- protein / peptide receptor ligand (PRs), DAMP or element that activates the complement system. Particular immunological adjuvant elements and nucleic acid sequences encoding them intended for use in the present invention are, inter alia, disclosed in WO 2017/081082 A2, which is incorporated herein by reference in its entirety. Elements that promote the presentation of antigens
[00230] [00230] The term "element that promotes the presentation of antigen" refers to (poly) peptides or proteins that are capable of mediating the promotion of entry into the lysosomal / protein pathway
[00231] [00231] The elements that promote antigen presentation can, for example, be adequately (additionally) encoded by artificial nucleic acid (RNA) molecules that encode (polypeptides or antigenic proteins), to intensify the processing and presentation of the encoded antigens, however, elements that promote antigen presentation can be useful in combination with any other (poly) peptide or protein of interest. When used in combination with a (poly) peptide or protein of interest, elements that promote the presentation of the antigen can be placed at the N-terminal, C-terminal and / or inside the said (poly) peptide or protein of interest, or their combinations. At the nucleic acid level, the coding sequence for these elements that promote antigen presentation are typically placed in the structure (that is, in the same reading structure), 5 'na, 3' na or within the coding sequence of (poly ) peptide or protein of interest.
[00232] [00232] “Exemplary elements that promote antigen presentation can be selected from the MHC invariant chain (li), invariant chain lysosome targeting signal (li), membrane protein classification signal associated with the LAMP-1 lysosome, lysosomal-11 integral membrane protein (LIMP-II) and C1C2 Lactadherin domain. Particular elements that promote the presentation of antigens and nucleic acid sequences encoded for use in the present invention are, inter alia, disclosed in WO 2017/081082 A2, which is incorporated herein by reference in its entirety .
[00233] [00233] The "viral 2A peptides" (also called "autocleavage" peptides) are (poly) peptides or proteins that allow the expression of several proteins from a single open reading frame. The terms "peptide 2A" and "element 2A" are used here interchangeably. The mechanism by the 2A sequence to generate two proteins from a transcript is through ribosome omission - a normal peptide bond is impaired by 2A, resulting in two discontinuous protein fragments from a translation event.
[00234] [00234] 2A peptides may, for example, be suitably (additionally) encoded by artificial nucleic acid (RNA) molecules that encode (poly) peptides or proteins that require cleavage. For example, 2A peptides can be inserted into polypeptide fusions between two or more antigenic (poly) peptides, or between a protein of interest and a signal peptide. The coding sequence for that 2A peptide is typically located between the (poly) peptide or protein coding sequences. The autocleavage of peptide 2A preferably produces at least one (polypeptide or protein of interest (for example, a protein of interest without its signal peptide or two (poly) peptides or antigenic proteins of interest). 2A can also be appropriately encoded by artificial nucleic acid (RNA) molecules that encode (poly) peptides or multi-chain proteins of interest, such as antibodies, Such artificial nucleic acid (RNA) molecules may comprise, for example, two coding sequences that encode two chains of antibodies separated by a nucleic acid sequence that encodes a 2A peptide.
[00235] [00235] “When used in combination with a polypeptide or protein of interest in the context of the present invention, 2A peptides can be placed at the N-terminus, C-terminus and / or within (po-
[00236] [00236] Exemplary 2A peptides can be derived from foot-and-mouth disease virus, equine rhinitis A virus, Thosea asigna virus, porcine teschovirus-1. Particular 2A peptides and nucleic acid sequences encoding them intended for use in the present invention are, inter alia, disclosed in WO 2017/081082 A2, which is incorporated herein by reference in its entirety. Isoforms, homologues, variants, fragments and derivatives
[00237] [00237] Each of the (poly) jpeptides and proteins of interest and, where applicable, each additional marker, sequence, ligand, element or domain disclosed in this invention, also includes isoforms, homologs, variants, fragments and their derivatives . Thus, the artificial nucleic acid (RNA) molecules of the invention can encode in at least one coding region, at least one therapeutic, antigenic or allergenic (poly) peptide or protein and, optionally, at least one marker, sequence, ligand, element or domain as disclosed herein, or its isoform, homolog, variant, fragment or derivative. Such isoforms, homologues, variants, fragments and derivatives are preferably functional, that is, they present the same desired biological properties and / or capable of exercising the same desired biological function as the respective (poly) peptide, protein, marker indicator, sequence, linker, element or domain. For example, isoforms, homologues, variants, fragments and derivatives of therapeutic (poly) peptides or proteins are preferably capable of mediating the desired therapeutic effect. Isoforms, homologues, variant, fragments and derivatives of (poly) peptides or antigenic proteins
[00238] [00238] The term "isoform" refers to variants of post-translational modification (PTM) of (poly) peptides, proteins or amino acid sequences as disclosed in this invention. PTMs can result in covalent or non-covalent modifications of a given protein. Common post-translational modifications include glycosylation, phosphorylation, ubiquitinylation, S-nitrosylation, methylation, N-acetylation, lipidation, disulfide bond formation, sulfation, acylation, deamination, etc. Different PTMs can result, for example, in different chemicals, activities, locations, interactions or configurations.
[00239] [00239] The term "homologous" includes "orthologists" and "paralogs". "Orthologists" are (poly) peptides or proteins or amino acid sequences encoded by genes from different species that evolved from a common ancestral gene through speciation. "Paralogs" are genes produced by duplicating genes within a genome.
[00240] [00240] The term "variant" in the context of (poly) peptides, proteins or amino acid sequences refers to "sequence variants (amino acids)", that is, (polypeptides, proteins or amino acid sequences with at least one mutation compared to a reference (or "origin") amino acid sequence. Amino acid mutations include amino acid substitutions, insertions or deletions. The term (substitution) "substitution" may refer to conservative or non-conservative amino acid substitutions In some embodiments, it may be preferable for a "variant" to essentially comprise conservative amino acid substitutions, in which the amino acids, originating in the same class, are exchanged for each other. amino acids having aliphatic side chains, positively or negatively charged side chains, aromatic groups on the side chains or amino acids, whose side chains can form hydrogen bonds, p for example, side chains with hydroxyl function. By conservative constitution, for example, an amino acid with a polar side chain can be replaced by another amino acid with a corresponding polar side chain or, for example, an amino acid characterized by a hydrophobic side chain can be replaced by another amino acid. acid with a corresponding hydrophobic side chain (for example, serine (threonine) by threonine (serine) or leucine (isoleucine) by isoleucine (leucine)).
[00241] [00241] Preferably, the term "variant", as used in this invention, includes naturally occurring variants, such as prepeptides, preproproteins, proproteins, which have undergone post-translational proteolytic processing (this may involve removal N-terminal methionine, signal peptide and / or the conversion of an inactive or non-functional protein into an active or functional protein), transcription variants, as well as (poly) peptides, proteins and sequences of naturally occurring mutated amino acid manipulated. The terms "transcription variants" or "splice variants" refer to variants of (poly) peptides, proteins or amino acid sequences produced from messenger RNAs that are initially transcribed from the same gene, but are subsequently submitted alternative (or differential) splices, where gene-specific exons can be included or excluded from the processed final messenger RNA (mMRNA). A "variant" as defined herein can be derived, isolated, related, based on or homologous to the reference (poly) peptide, protein or amino acid sequence. A "variant" (poly) peptide, protein or amino acid sequence can preferably have a sequence identity of at least 5%, 10%, 20%,
[00242] [00242] The term "fragment" in the context of (poly) peptides, proteins or amino acid sequences refers to (poly) peptides, proteins or amino acid sequences that consist of a continuous subsequence of the sequence of complete amino acid of one (polypeptide, proteins or reference amino acid sequences (or "source"). The "fragment" is, in relation to its amino acid sequence, N-terminal, C-terminal and / or intrasequently truncated compared to the reference amino acid sequence, which can occur at the amino acid level or the nucleic acid level, respectively. In other words, a "fragment" can typically consist of a larger portion short of a complete amino acid sequence and therefore preferably consists of an amino acid sequence that is identical to the corresponding stretch within a complete reference amino acid sequence. The term includes naturally occurring fragments (such as fragment the results of naturally occurring in vivo protease activity), as well as manipulated fragments. The fragments can be derived from (poly) peptides, proteins or naturally occurring amino acid sequences as disclosed herein, or from their isoforms, homologues or variants.
[00243] [00243] "A" fragment "may comprise at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least contiguous amino acid residues, at least 25 contiguous amino acid residues , at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino acid residues, at least 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 residues contiguous amino acid, at least 100 contiguous amino acid residues, at least 125 contiguous amino acid residues, at least 150 contiguous amino acid residues, at least 175 contiguous amino acid residues, at least 200 contiguous amino acid residues or at least 250 residues contiguous amino acid from the respective reference amino acid sequences.
[00244] [00244] It may be preferable that the "fragments" consist of a continuous stretch of amino acids corresponding to a continuous stretch of amino acids in the reference amino acid sequence, where the fragment corresponds to at least 20%, preferably at least 30% , more preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70% and most preferable at least 80% of the total reference amino acid sequence (i.e., length - total budget). A sequence identity indicated with respect to a "fragment" can preferably refer to the complete reference amino acid sequence. A (fragment) of (poly) peptide, protein or amino acid sequence can preferably have an amino acid sequence identity of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70% , 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, of preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%,
[00245] [00245] The term "derivative" in the context of (poly) peptides, proteins or amino acid sequences refers to modifications of a reference or "origin" (poly-) peptide, protein or amino acid sequence, including or lacking additional biological property or functionality. For example, "derivatives" of (polypeptide or protein can be modified by introducing or removing domains that confer particular biological functionality, such as the ability to bind to a (additional) target or an enzymatic activity. Other modifications can modulate pharmacokinetic / pharmacodynamic properties, such as stability, biological half-life, bioavailability, absorption, reduced distribution and / or clearance. "Derivatives" can be prepared through the introduction or exclusion of post-amino acid sequences. translational or at a nucleic acid sequence level (cf. using standard genetic engineering techniques (cf. Sambrook J et al., 2012 (4th ed.), Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.) A "derivative" may be derived from, that is, corresponding to a modified full-length wild type (poly) peptide, protein or amino acid sequence, or s an isoform, homolog, fragment or variant. The term "derivatives" further includes (poly) peptides, proteins or amino acid sequences that are chemically modified or modifiable after translation, for example, by PEGylation or PASylation.
[00246] [00246] According to some modalities, it is particularly preferable that if, in addition to the (poly) peptide or protein of interest, another (poly) peptide or protein is encoded by at least one coding sequence as defined herein - the peptide encodes - the protein or protein is preferably no histone protein, no reporter protein (eg Luciferase, GFP and their variants)
[00247] [00247] The artificial nucleic acid (RNA) molecule of the invention can encode any desired (poly) peptide or protein disclosed herein. Specifically, said artificial nucleic acid (RNA) molecule can comprise at least one coding region that encodes a (poly) peptide or protein that comprises or consists of an amino acid sequence according to any of SEQ ID NOs: 42-45 , or its counterpart, variant, fragment or derivative, preferably having an amino acid sequence that has, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96 %, 96%, 97%, 98%, or 99% sequence identity to the amino acid sequence according to any of SEQ ID NOs: 42-45, or a variant or fragment of any of those sequences.
[00248] [00248] - "Consequently, the artificial nucleic acid (RNA) molecule of the invention can preferably comprise or consist of a nucleic acid sequence according to any of SEQ ID NOs: 46-49; or a nucleic acid sequence that it has,
[00249] [00249] The present invention provides the beneficial combination of coding regions that encode (poly) peptides or proteins of interest operably linked to RTU elements as defined herein, in order to preferably increase the expression of said encoded proteins. Preferably, said artificial nucleic acids can thus comprise or consist of a nucleic acid sequence according to any of SEQ ID NOs: 50-368, or its (functional) variant, fragment or derivative, in particular the nucleic acid sequence that has, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97% sequence identity for any of these sequences. Nucleic acid molecules and RNAs
[00250] [00250] The terms "nucleic acid", "nucleic acid molecule" or "artificial nucleic acid molecule" means any DNA or RNA molecule and is used as a synonym for polynucleotide. Where as always here, reference is made to a nucleic acid or nucleic acid sequence that encodes a specific protein and / or peptide, said nucleic acid or nucleic acid sequence, respectively, preferably also comprises regulatory sequences that allow a host suitable, for example, a human being, its expression, i.e., transcription and / or translation of the nucleic acid sequence encoding the specific protein or peptide.
[00251] [00251] The artificial nucleic acid molecule of the invention can be a DNA or preferably an RNA. It will be understood that the term "RNA!" refers to ribonucleic acid molecules characterized by the specific succession of their nucleotides joined to form the said molecules (that is, their RNA sequence). The term "RNA" can therefore be used to refer to RNA molecules or RNA sequences, as will be easily understood by the person skilled in the respective context. For example, the term "RNA" as used in the context of the invention, preferably refers to an RNA molecule (said molecule being characterized, inter alia, by its particular RNA sequence). In the context of the sequence modifications disclosed in this invention, the term "RNA" will be understood as relating to the (modified) RNA sequences, but typically also includes the resulting RNA molecules (which are modified in relation to their sequence). In preferred embodiments, the RNA can be an mMRNA, a viral RNA, a self-replicating RNA or a replicating RNA, preferably an mRNA. Mono-, bi- or multicistronic RNAs
[00252] [00252] In preferred embodiments, the artificial nucleic acid (RNA) molecule of the invention can be mono-, bi- or multicistronic. Bi or multicistronic RNAs typically comprise two (bicistronic) or more (multicistronic) open reading frames (ORF).
[00253] [00253] An open reading frame in this context is a codon sequence that is translatable into a peptide or protein. The coding sequences in a bi- or multicistronic artificial nucleic acid (RNA) molecule can encode it or, preferably, (polypeptides or distinct proteins of interest. In this context, (polypeptides or "distinct" proteins means) ) peptides or proteins being encoded by different genes, having a different amino acid sequence, presenting biochemical or bio-
[00254] [00254] —Bi or even multicistronic artificial nucleic acid (RNA) molecules, can code, for example, two or more, that is, at least two, three, four, five, six or more (poly) peptides or proteins of interest (preferably distinct).
[00255] [00255] In some embodiments, coding sequences that encode two or more (poly) peptides or proteins of interest (preferably distinct) can be separated into the bi- or multicistronic artificial nucleic acid (RNA) molecule for at least one second. IRES (internal ribosomal entry site). The term "IRES" (internal ribosomal entry site) refers to an RNA sequence that allows translation to begin. An IRES can function as a single ribosome binding site, but it can also serve to provide a bi- or even multicistronic artificial nucleic acid (RNA) molecule that encodes several (poly) peptides or (preferably distinct) proteins from interest (or its counterparts, variants, fragments or derivatives), which must be translated by ribosomes independently of each other. Examples of IRES sequences, which can be used according to the invention, are those derived from picornavirus (for example, FMDV), pestivirus (CFFV), polio-virus (PV), encephalomyocarditis virus (ECMV), foot-and-mouth disease
[00256] [00256] “According to other modalities, the at least one coding sequence of the artificial nucleic acid (RNA) molecule of the invention can encode at least two, three, four, five, six, seven, eight and more, preferably distinct, (poly) peptides or proteins of interest linked or without an amino acid linker sequence, wherein said linker sequence may comprise rigid ligands, flexible ligands, cleavable ligands (for example, self-ligating peptides) or a combination of them.
[00257] Preferably, the artificial nucleic acid (RNA) molecule comprises a length of about 50 to about 20,000 or 100 to about 20,000 nucleotides, preferably from about 250 to about 20,000 nucleotides, more preferably from about 500 to about 10,000, even more preferably from about 500 to about 5000.
[00258] [00258] The artificial nucleic acid (RNA) molecule of the invention can also be single-stranded or double-stranded. When supplied as a double-stranded RNA or DNA, the artificial nucleic acid molecule preferably comprises a corresponding sense and antisense strand. Nucleic acid changes
[00259] [00259] The artificial nucleic acid molecules, preferably RNAs, of the invention, can be supplied in the form of modified nucleic acids. Suitable nucleic acid modifications envisaged in the context of the present invention are described below.
[00260] [00260] According to preferred embodiments, the at least one artificial nucleic acid (RNA) molecule of the invention can be "modified", that is, it comprises at least one con-
[00261] [00261] The artificial nucleic acid molecules of the invention can be modified in their nucleotides, more specifically in the main phosphate chain, in the sugar component or in the nucleobases. In other words, the present invention provides that a "modified" artificial nucleic acid (RNA) molecule may contain nucleotide / nucleoside analogues / modifications (modified nucleotides or nucleosides), for example, modifications of the main chain , sugar modifications or nucleobase modifications. Changes in the phosphate backbone
[00262] [00262] The artificial nucleic acid molecules of the invention can comprise modifications in the main chain, i.e., nucleotides that are modified in the phosphate main chain. The term "backbone modification" refers to chemical modifications of the nucleotide phosphate backbone, which can stabilize the modified backbone nucleic acid molecule. A "modification of the main chain" is therefore understood as a modification, in which the phosphates of the main chain of the nucleotides contained in said artificial nucleic acid (RNA) molecule are chemically modified.
[00263] [00263] The phosphate groups of the main chain can be modified by replacing one or more oxygen atoms with a different substituent. In addition, the modified nucleotides may include the complete replacement of an unmodified phosphate fraction with a modified phosphate, as described herein.
[00264] [00264] “Examples of modified phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, borane phosphates, borane phosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates and phosphotriesters. Phosphorodithioates have both non-bonding oxygen replaced by sulfur. The phosphate binder can also be modified by replacing a bonding oxygen with nitrogen (bridged phosphoramamidates), sulfur (bridged phosphorothioates) and carbon (bridged methylene phosphonates).
[00265] [00265] Preferably, the artificial nucleic acid molecules "modified by the main chain", preferably RNAs, may comprise phosphorothioate-modified backbones, wherein preferably at least one of the phosphate oxygen contained in the phosphate backbone is replaced by a sulfur atom. Other suitable modifications of the phosphate backbone include the incorporation of non-ionic phosphate analogs, such as, for example, alkyl and aryl phosphonates, in which the charged phosphate oxygen is replaced by an alkyl or aryl group, or phosphodiester and alkylphosphotriesters, in which the charged oxygen residue is present in the alkylated form. Such modifications to the main chain typically include, without limitation, modifications to the group consisting of methylphosphonates, phosphoramidates and phosphorothioates (e.g., cytidine-5'-O- (1-thiophosphate)).
[00266] [00266] The artificial nucleic acid molecules of the invention can comprise sugar modifications, i.e., nucleotides that are modified in their sugar component. The term "sugar modification" refers to the chemical modifications of the sugar component of the nucleotides. A "sugar modification" is therefore understood as a chemical modification of the sugar in the nucleotides of the artificial nucleic acid (RNA) molecule.
[00267] [00267] - For example, the 2 'hydroxyl group (OH) can be modified or replaced by a number of different "oxy" or "deoxy" substituents. Examples of modifications in the 2 'hydroxyl group "oxy" include, but are not limited to, alkoxy or aryloxy (-OR, for example, R = H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl or sugar); polyethylene glycols (PEG), O (CH2CH20) nCH2CH2OR; "blocked" nucleic acids (LNA) in which the 2 'hydroxyl is linked, for example, by a methylene bridge, to the 4' carbon of the same ribose sugar; and amino groups (-O-amino, where the amino group, for example, NRR, can be alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino or dietaryarylamino, ethylene diamine, polyamine) or aminoalkoxy.
[00268] [00268] "Deoxy" modifications include hydrogen, amino (e.g., NH> z; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, dietaryarylamino or amino acid); or the amino group can be linked to the sugar via a linker, wherein the linker comprises one or more of the C, Ne O atoms.
[00269] [00269] The modified sugar components may contain one or more carbons that have the opposite stereochemical configuration compared to the stereochemical configuration of the corresponding carbon in ribose. Thus, a sugar-modified artificial nucleic acid (RNA) molecule may include nucleotides containing,
[00270] [00270] The artificial nucleic acid molecules of the invention can comprise modifications of the nucleobase, i.e., nucleotides that are modified in their component of the nucleobase. The term "nucleobase modification" refers to chemical modifications of the nucleobase fraction of the nucleotides. A "modification of the nucleobase" is therefore understood as a chemical modification of the nucleobase of the nucleotides of the artificial nucleic acid (RNA) molecule. Suitable nucleotides or nucleosides that are modified in their nucleobase component (also referred to as "nucleoside analog" or "nucleotide analogs") can advantageously increase the stability of the artificial nucleic acid (RNA) molecule and / or improve the expression of a (poly) peptide or protein encoded by its at least one coding region.
[00271] [00271] Examples of nucleobases found in RNA include, but are not limited to, adenine, guanine, cytosine and uracil. For example, the nucleotides described herein can be chemically modified on the face of the main notch. In some embodiments, the major chemical modifications of the notch may include an amino group, a thiol group, an alkyl group or a halo group.
[00272] [00272] “When referring to the" preferred nucleoside modifications (nucleoside analogs) "below, the respective modified nucleotides (nucleotide analogs) are also predicted and vice versa.
[00273] [00273] In some embodiments, nucleotide analogues / modifications are selected from nucleobase modifications, which are preferably selected from 2-amino-6-chloropurinarriboside-5 '"- triphosphate, 2-Aminopurine-riboside -5'-triphosphate; 2-amino-denosine-5 '"- triphosphate, 2'-Amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-
[00274] [00274] In some embodiments, the modified nucleosides include pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio- pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudourourin taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl- pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudou-ridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxyuridine 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, and 4-methoxy-2-thio-pseu-
[00275] [00275] In some embodiments, the modified nucleosides include 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcitidine, N4-methylcitidine, 5-hydroxymethylcitidine, 1-methyl-pseudoisocitine, -cytidine, pyrrole-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocitidine, 4-thio-1-methyl-pseudo-socitidine, 4-thio-1-methyl - 1-deaza-pseudoisocitidine, 1-methyl-1-deaza-pseu- twoocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2- thio-zebularine, 2-thio-zebularine, 2 -methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-1-methyl-pseudoiso-cytidine.
[00276] [00276] In other embodiments, the modified nucleosides include 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza -8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methylenedosine, N6-methyladenosine, N6-isopentenyladenosine, N6- ( cis-hydroxyxisopentenyl) adenosine, 2-methylthio-N6- (cis-hydroxyisopentenyl) adenosine, N6-glycynylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonyl! carbamoyladenosine, N6, N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine and 2-methoxy-adenine.
[00277] [00277] In other embodiments, the modified nucleosides include inosine, 1-methyl-inosine, wiosine, wibutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6 -tio-7-deaza-guano-sine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine , 1-methylguanosine, N2-methylguanosine, N2, N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine and N2, N2-dimethyl-6-thio-guanosine.
[00278] [00278] In some embodiments, the nucleotide may be modified on the face of the main notch and may include the replacement of the
[00279] [00279] In some embodiments, the modified artificial nucleic acid (RNA) molecule of the invention may comprise nucleoside modifications selected from 6-aza-cytidine, 2-thio-cytidine, a-thio-cytidine, Pseudo-iso- cytidine, 5-aminoalyl-uridine, 5-iodo-uridine, N1- methyl-pseudouridine, 5,6-dihydrouridine, α-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, 5-methyl-uridine, Pyrrolo-cytidine, inosine, a-thio-guanosine, G-methyl-gquanosine, 5-methyl-citdine, 8-0x0-guanosine, 7-deaza-guanosine, N1i-methyl- adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, pseudo-iso-cytidine, 6-chloro-purine, N6-methyl-adenosine, a-thio-adenosine, 8-azido- adenosine, 7-deazaadenosine.
[00280] [00280] In some embodiments, a modified artificial nucleic acid (RNA) molecule (or any other nucleic acid, in particular RNA, as defined herein) does not comprise any of the chemical modifications as described herein. Such modified artificial nucleic acids can, however, comprise a lipid modification or a sequence modification as described below. Lipid modifications
[00281] [00281] According to other embodiments, the artificial nucleic acid molecules (RNAs) of the invention can contain at least one lipid modification.
[00282] Such an "lipid-modified" artificial nucleic acid molecule (RNA) of the invention typically comprises (i) an artificial nucleic acid (RNA) molecule, as defined herein, (ii) at least one ligand covalently linked to the said artificial nucleic acid (RNA) molecule, (iii) at least one lipid covalently linked to the
[00283] [00283] —Alternatively, the "lipid-modified" artificial nucleic acid molecule (RNA) can comprise at least one artificial nucleic acid (RNA) molecule and at least one covalently bound (bifunctional) lipid (without a linker ) to said artificial nucleic acid (RNA) molecule.
[00284] [00284] —Alternatively, the "lipid-modified" artificial nucleic acid (RNA) molecule may comprise (i) an artificial nucleic acid (RNA) molecule, (ii) at least one ligand covalently linked to said molecule of artificial nucleic acid (RNA) and (iii) at least one lipid covalently linked to the respective ligand, and further (iv) at least one lipid (bifunctional) covalently linked (without a ligand) to said artificial nucleic acid molecule (RNA).
[00285] [00285] In this context, it is particularly preferable that the lipid modification is present at the terminal ends of a linear artificial nucleic acid (RNA) molecule. String modifications
[00286] [00286] According to preferred embodiments, the artificial nucleic acid (RNA, preferably mRNA) molecule of the invention is "modified in the sequence", that is, it comprises at least one sequence modification as described below. Without wishing to be limited to a specific theory, these sequence modifications can increase the stability and / or enhance the expression of the artificial nucleic acid molecules (RNAs) of the invention. Modification of G / C content
[00287] [00287] According to the preferred modalities, the artificial nucleic acid (RNA) molecule, more preferably mRNA, of the invention, can be modified and, therefore, stabilized, by modifying its guanosine / cytosine content (G / C), preferably by modifying the G / C content of at least one coding sequence. In other words, the artificial nucleic acid (RNA) molecule can preferably be modified by G / C, that is, it preferably comprises the modified G / C sequence (coding).
[00288] [00288] A "G / C modified" nucleic acid (RNA) sequence typically refers to a nucleic acid (RNA) that comprises a nucleic acid (RNA) sequence that is based on an acid sequence modified wild-type nucleic acid (RNA) and comprises a change in the number of guanosine and / or cytosine nucleotides compared to said wild-type nucleic acid (RNA) sequence. This altered number of G / C nucleotides can be generated by replacing codons containing adenosine or thymidine nucleotides with "synonymous" codons containing guanosine or cytosine nucleotides. Accordingly, codon substitutions preferably do not alter the codified amino acid residues, but only alter the nucleic acid (RNA) G / C content.
[00289] [00289] In a particularly preferred embodiment of the present invention, the G / C content of the coding sequence of the artificial nucleic acid (RNA) molecule of the invention is modified, particularly increased, compared to the G / C content of the respective wild-type coding sequence, i.e., unmodified nucleic acid (RNA). The amino acid sequence encoded by the artificial nucleic acid molecule of the invention (RNA) is preferably not modified compared to the amino acid sequence encoded by the respective wild-type nucleic acid (RNA).
[00290] [00290] The provision of "modified G / C" nucleic acid molecules (RNAs) is based on the discovery that nucleic acid (RNA) sequences having an increased content of G (guanosine) / C ( cytosine) are generally more stable than nucleic acid (RNA) sequences having an increased content of A (adenosine) / U (uracil).
[00291] [00291] “According to the invention, the codons of the artificial nucleic acid molecule of the invention (RNA) are therefore varied in comparison to the respective wild-type nucleic acid (RNA), maintaining the translated amino acid sequence , so it includes an increased amount of G / C nucleotides.
[00292] [00292] Regarding the fact that several codons encode the same amino acid (the so-called degeneration of the genetic code), the most favorable codons for stability can be determined (so-called alternative use of codons). Depending on the amino acid to be encoded by the artificial nucleic acid (RNA) molecule of the invention, there are several possibilities for modifying its nucleic acid sequence, as compared to the wild type sequence. In the case of amino acids, which are coded for by codons, which contain only G or C nucleotides, no codon modification is necessary.
[00293] [00293] Thus, the codons for Pro (CCC or CCG), Arg (CGC or CGG), Ala (GCC or GCG) and Gly (GGC or GGG) do not need modification, since no A or U is present. On the other hand, codons that contain A and / or U nucleotides can be modified by replacing other codons, which encode the same amino acids, but do not contain A and / or U. Examples of these are: codons for Pro can be changed from CCU or CCA to CCC or CCG; codons for Arg can be changed from CGU or CGA or AGA or AGG to CGC or CGG; codons for Ala can be changed from GCU or GCA to GCC or GCG; codes for Gly can be changed from GGU or GGA to GGC or GGG. In other cases, although the nucleotides of A or U cannot be eliminated from the codons, it is nevertheless possible to decrease the content of A and U using codons that contain a lower nucleotide content of A and / or U. Examples of these are: codons for Phe can be changed from UUU to UUC; codons for Leu can be changed from UUA, UUG, CUU or CUA to CUC or CUG; codes for Ser can be changed from UCU or UCA or AGU to UCC, UCG or AGC; the codon for Tyr can be changed from WOW to UAC; the codon for Cys can be changed from UGU to UGC; the codon for His can be changed from CAU to CAC; the codon for Glh can be changed from CAA to CAG; the codons for it can be changed from AUU or AUA to AUC; the codons for Thr can be changed from ACU or ACA to ACC or ACG; the codon for Asn can be changed from AAU to AAC; the codon for Lys can be changed from AAA to AAG; the codons for Val can be changed from GUU or GUA to GUC or GUG; the codon for Asp can be changed from GAU to GAC; the codon for Glu can be changed from GAA to GAG; the stop codon UAA can be changed to UAG or UGA.
[00294] [00294] Preferably, the G / C content of the coding sequence of the artificial nucleic acid (RNA) molecule of the invention can be increased by at least 7%, more preferably by at least 15%, particularly preferable by at least 20 %, compared to the G / C content of the wild-type nucleic acid (RNA) coding sequence that codes for the same (poly) peptide or protein of interest.
[00295] [00295] “According to preferred modalities, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, more preferably at least 70%, even more preferably at least 80% and the most Preferably at least 90%, 95% or even 100% of the replaceable codons in the region encoding a (poly) peptide or protein of interest or the entire wild type nucleic acid (RNA) sequence sequence can be substituted, thus increasing the G / C content of the resulting "modified G / C" sequence.
[00296] [00296] In this context, it is particularly preferable to increase the G / C content of the artificial nucleic acid (RNA) molecule, preferably from its at least one coding sequence, to the maximum (that is, 100% of the replaceable codons) compared to the wild-type nucleic acid (RNA) sequence. Replacement of rare codons
[00297] [00297] Another preferred modification of the artificial nucleic acid (RNA) molecule is based on the finding that the efficiency of the translation is also determined by a different frequency in the occurrence of tRNAs in the cells. Thus, if the so-called "rare codons" are present in the artificial nucleic acid (RNA) molecule to a greater extent, the corresponding modified nucleic acid (RNA) sequence will be translated less efficiently than a sequence.
[00298] [00298] In some preferred embodiments, in the modified artificial nucleic acid molecules (RNAs) of the invention, the coding region is thus modified compared to the coding region for wild-type nucleic acid (RNA) corresponding, such that at least one codon of the wild type sequence, which encodes a tRNA that is relatively rare in the cell, is exchanged for a codon, which encodes a tRNA that is relatively frequent in the cell and carries the same amino acid that relatively rare tRNA.
[00299] [00299] In this way, the sequences of the artificial nucleic acid (RNA) molecule of the invention are modified in such a way that the codes for which frequently occurring tRNAs are available are inserted.
[00300] [00300] - Thus, all codons of the wild type nucleic acid (RNA) sequence, which encode a relatively rare tRNA in the cell, can, in each case, be exchanged for a codon, which encodes a tRNA that is relatively frequent in the cell and which, in each case, carries the same amino acid as the relatively rare tRNA. The frequency of specific tRNAs in the cell is well known to the knowledgeable person; cf. for example. Akashi, Curr. Opin. Genet. Dev. 2001, 11 (6): 660-666. The codons that recruit the most frequent tRNA for a given amino acid (for example, Gly) in the (human) cell are particularly preferred.
[00301] [00301] According to the invention, it is particularly preferable to combine a modified (preferably increased, more preferably maximized) G / C with the use of "frequent" codons as described above, without modifying the amino acid sequence encoded by the sequence of encoding said artificial nucleic acid (RNA) molecule. Such "combined" modifications are preferentially
[00302] [00302] The modified artificial nucleic acid molecules (RNAs) that exhibit the sequence modifications described in this invention (for example, increased G / C content and tRNA exchange) can be supplied with the help of computer programs as explained in WO 02/098443, whose disclosure content is included in its full scope in the present invention. Using this computer program, the nucleotide sequence of any desired nucleic acid, in particular RNA, can be modified in silico to obtain modified artificial nucleic acid molecules (RNAs) with a nucleic acid sequence (RNA) ) which has a maximum G / C content in combination with codons that recruit frequent tRNAs, while encoding the same (unmodified) amino acid sequence as a respective wild-type nucleic acid (RNA) sequence.
[00303] [00303] Alternatively, it is also possible to modify the G / C content or the use of the codon individually, in comparison with a reference sequence. The source code in Visual Basic 6.0 (development environment used: Microsoft Visual Studio Enterprise 6.0 with Servicepack 3) is also described in WO 02/098443. Modification of A / U content
[00304] [00304] According to other preferred embodiments, the A / U content at or near the ribosome binding site of the artificial nucleic acid (RNA) molecule of the invention is increased compared to the A / U content at the ribosome binding site or near the site of a respective wild-type nucleic acid (RNA). Increasing the A / U content around the ribosome binding site can preferably increase the effectiveness of the ribosome binding. Effective binding of the ribosome to the ribosome binding site (sequence of
[00305] [00305] According to other preferred embodiments, the artificial nucleic acid (RNA) molecule can be modified in relation to potentially destabilizing sequence elements. In particular, the coding sequence and / or the 5 'and / or 3' untranslated region of said artificial nucleic acid (RNA) molecule can be modified in comparison to the respective wild-type nucleic acid (RNA) by removing any destabilizing sequence elements (DSEs), while the encoded amino acid sequence of the modified artificial nucleic acid (RNA) molecule is preferably not being modified compared to its respective wild-type nucleic acid (RNA).
[00306] [00306] Eukaryotic RNAs can comprise destabilizing sequence elements (DSE), which can design signal proteins that act as a mediator of enzymatic degradation of the nucleic acid (RNA) molecule in vivo. Exemplary DSEs include AU-rich sequences (AURES), which occur in the 3-RTU of numerous unstable RNAs (Caput et al., Proc. Natl. Acad. Sci. USA 1986, 83: 1670 to 1674). Also included by the term are sequence motifs, which are recognized by possible endonucleases, for example, the GAACAAG sequence, which is contained in the 3'-UTR segment of the gene encoding the transferrin receptor (Binder et al., EMBO J 1994, 13: 1969 to 1980).
[00307] [00307] “By removing or substantially removing these DSEs from the nucleic acid sequence of the artificial nucleic acid (RNA) molecule of the invention, in particular its coding region and / or its 3'- and / or 5 elements -UTR, the artificial nucleic acid (RNA) molecule is preferably stabilized.
[00308] [00308] The artificial nucleic acid (RNA) molecule of the invention can therefore be modified in comparison to a respective wild-type nucleic acid (RNA), so that said artificial nucleic acid (RNA) molecule is devoid of elements destabilizing sequences (DSEs). Sequences adapted to the use of human codons:
[00309] [00309] “Another preferred modification of the artificial nucleic acid (RNA) molecule of the invention is based on the finding that codons encoding the same amino acid typically occur at different frequencies.
[00310] [00310] According to other preferred embodiments, in the modified artificial nucleic acid (RNA) molecule, the coding sequence is modified in comparison to the corresponding region of the respective wild-type nucleic acid (RNA), so that the frequency of codons encoding the same amino acid corresponds to the natural frequency of that codon according to the use of the human codon, as, for example, shown in Table 2.
[00311] [00311] For example, the coding sequence for a molecule of wild-type nucleic acid (RNA) can be adapted in such a way that the codon "GCC" (for Ala) is used with a frequency of 0.40, the codon "GCT" (for Ala) is used with a frequency of 0.28, codon "GCA" (for Ala) is used with a frequency of 0.22 and codon "GCG" (for Ala) is used with a frequency of 0.10 etc. (see Table 2). Table 2: Human codon usage table
[00312] [00312] As described above, in the preferred embodiments of the present invention, all codons in the wild-type nucleic acid sequence that encode a relatively rare tRNA can be exchanged for a codon that encodes a relatively frequent tRNA that carries the same amino acid than the rare tRNA.
[00313] [00313] It is particularly preferable that the most frequent codons are used for each coded amino acid (see Table 2, the most frequent codons are marked with asterisks). Such an optimization procedure increases the codon adaptation index (CAI) and, finally, maximizes the CAI. In the context of the invention, nucleic acid (RNA) sequences with increased or maximized CAI are typically referred to as "codon optimized" and / or "increased CAI" and / or "maximized" nucleic acid (RNA) sequences . According to preferred embodiments, the artificial nucleic acid (RNA) molecule of the invention comprises at least one coding sequence, wherein the coding sequence is "codon optimized" as described herein. More preferably, the codon adaptation index (CAI) of the at least one coding sequence can be at least 0.5, at least 0.8, at least 0.9 or at least 0.95. More preferably, the codon adaptation index (CAI) of the at least one coding sequence can be 1.
[00314] [00314] For example, the coding sequence for a wild-type nucleic acid (RNA) molecule can be adapted in such a way that the most frequent (human) codon is always used for each encoded amino acid, for example, "GCC" for Ala or "TGC" for Cys. C-optimized strings:
[00315] [00315] According to preferred modalities, the artificial nucleic acid (RNA) molecule is modified by altering, preferably increasing, the cytosine (C) content of its nucleic acid sequence (RNA), in particular in its at least one coding sequence.
[00316] [00316] In the preferred embodiments, the C content of the coding sequence of the artificial nucleic acid (RNA) molecule of the invention is modified, preferably increased, compared to the C content of the coding sequence of the respective nucleic acid of the wild type (unmodified) (RNA). The amino acid sequence encoded by at least one coding sequence for the artificial nucleic acid (RNA) molecule of the invention is preferably not modified compared to the amino acid sequence encoded by the respective wild-type nucleic acid (RNA).
[00317] [00317] In the preferred embodiments, said modified artificial nucleic acid (RNA) molecule can be modified so that at least 10%, 20%, 30%, 40%, 50%, 60%, 70% or 80% or at least 90% of the maximum theoretically possible cytosine content or even a maximum cytosine content is achieved.
[00318] [00318] In other preferred embodiments, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or even 100% of the codons of the wild-type nucleic acid sequence (RNA), which are "optimizable in cytosine content" are replaced by codons having a higher cytosine content than those present in the wild type sequence.
[00319] [00319] In other preferred embodiments, some of the codons in the wild-type coding sequence can be further modified so that a codon for a relatively rare tRNA in the cell is exchanged for a codon for a relatively frequent tRNA in the cell, provided that the codon substituted for a relatively frequent tRNA carries the same amino acid as the relatively rare tRNA of the original wild-type codon. Preferably, all the codons of a relatively rare tRNA can be replaced by a codon of a relatively frequent tRNA in the cell, except for codons that encode amino acids, which are encoded exclusively by codons that do not contain cytosine or except for glutamine (Gln), which is encoded by two codons, each containing the same number of cytosines.
[00320] [00320] In other preferred embodiments of the present invention, the modified artificial nucleic acid (RNA) molecule can be modified so that at least 80%, or at least 90% of the maximum theoretically possible cytosine content or even even a maximum level of cytosine is achieved through codons, which encode relatively frequent tRNAs in the cell, in which the amino acid sequence encoded by at least one coding region remains unchanged.
[00321] [00321] “Due to the natural degeneration of the genetic code, more than one codon can encode a particular amino acid. Consequently, 18 out of 20 naturally occurring amino acids are encoded by more than one codon (with Tryp and Met being an exception), for example, through 2 codons (eg, Cys, Asp, Glu), through - through three codons (for example, Ile), through 4 codons (for example, Al, Gly, Pro) or through 6 codons (for example, Leu, Arg, Ser). However, not all codons that encode the same amino acid are used with the same frequency under in vivo conditions. Depending on each organism, a typical codon usage profile is established.
[00322] [00322] The term "codon with optimizable cytosine content" refers to codons, which have a lower cytosine content than other codons that encode the same amino acid. Accordingly, any wild-type codon, which can be replaced by another codon that encodes the same amino acid and which has a greater number of cytosines within that codon, is considered to be cytosine optimized (C-optimizable). Any replacement of this type of C-optimized wild-type codon with the specific C-optimized codon within a wild-type coding sequence increases its overall C content and reflects a modified C-enriched nucleic acid (RNA) sequence.
[00323] [00323] “According to some preferred embodiments, the artificial nucleic acid (RNA) molecule of the invention, and in particular its at least one coding sequence, comprises or consists of a C-maximized sequence containing C-optimized codons for all potentially C-optimized codons. Consequently, 100% or all theoretically replaceable C-optimized codons can preferably be replaced with C-optimized codons over the entire length of the coding sequence.
[00324] [00324] In this context, codons optimizable in cytosine content are codons, which contain fewer cytosines than other codons that encode the same amino acid.
[00325] [00325] “Any of the codons GCG, GCA, GCU encode the amino acid Ala, which can be exchanged for the GCC codon that encodes the same amino acid and / or the UGU codon that encodes Cys can be exchanged for the UGC codon that encodes the same amino acid and / or the codon GAU coding for Asp can be exchanged for the codon
[00326] [00326] In any of the above cases, the number of cytosines is increased by 1 per exchanged codon. The exchange of all non-C optimized codons (corresponding to the C optimizable codons) of the coding sequence results in a "C maximized" coding sequence. In the context of the invention, at least 70%, preferably at least 80%, more preferably at least 90%, of the non-optimized C-codons within at least one coding sequence for the artificial nucleic acid (RNA) molecule of the invention can be replaced by "C-optimized" codons.
[00327] [00327] It may be preferable that for some amino acids the percentage of C-optimized codons replaced by C-optimized codons is less than 70%, while for other amino acids the percentage of substituted codons may be greater than 70% for meet the overall C optimization percentage of at least 70% of all C optimizable wild-type codons in the coding sequence.
[00328] [00328] Preferably, in a "C-optimized" artificial nucleic acid (RNA) molecule, at least 50% of the C-optimized wild-type codons for any given amino acid can be replaced by "C-optimized" codons , for example, any modified C-enriched nucleic acid (RNA) molecule preferably contains at least 50% of C-optimized codons in the positions of C-optimizable wild-type codons that encode any of the aforementioned amino acids Ala, Cys , Asp, Phe, Gly, His, Ile, Leu, Asn, Pro, Arg, Ser, Thr, Val and Tyr, preferably at least 60%.
[00329] [00329] In this context, codons that encode amino acids, which are not optimizable by the content of cytosine and which are, however, encoded
[00330] [00330] Consequently, the relatively rare GAA codon encoding Glu can be exchanged for the relatively frequent codon GAG encoding the same amino acid and / or the relatively rare AAA codon encoding Lys can be exchanged for the relative AAG codon coding for the same amino acid and / or the relatively rare codon CAA encoding GIn can be exchanged for the frequent relative codon CAG encoding the same amino acid.
[00331] [00331] In this context, the amino acids Met (AUG) and Trp (UGG), which are encoded by only one codon each, remain unchanged. Stop codons are not optimized for the cytosine content; however, the relatively rare amber, ocher stop codons (UAA, UAG) can be exchanged for the relatively frequent opal stop codon (UGA).
[00332] [00332] The isolated substitutions listed above can be used individually, as well as in all possible combinations, in order to optimize the cytosine content of the modified artificial nucleic acid (RNA) molecule, compared to a respective sequence of wild-type nucleic acid (RNA).
[00333] [00333] Accordingly, at least one coding sequence as defined herein can be modified compared to the coding sequence of the respective wild-type nucleic acid (RNA) sequence, so that the codons are exchanged for codons C-optimized cells comprising additional cytosines and encoding the same amino acid, i.e., the encoded amino acid sequence is preferably not modified compared to the encoded wild-type amino acid sequence.
[00334] [00334] In accordance with particularly preferred embodiments, the artificial nucleic acid (RNA) molecule of the invention comprises (in addition to the 5 'UTR and 3' UTR element specified herein) at least one coding sequence as defined herein, wherein (a) the G / C content of at least one coding sequence for said artificial nucleic acid (RNA) molecule is increased compared to the G / C content of the coding sequence for wild-type nucleic acid ( Corresponding RNA and / or (b) where the C content of at least one coding sequence for said artificial nucleic acid (RNA) molecule is increased compared to the C content of the nucleic acid coding sequence corresponding wild type (RNA) and / or (c) where the codons in at least one coding sequence for said artificial nucleic acid (RNA) molecule are adapted to the use of human codons, in which the index codon adaptation (CAI) is preferably increased or maximized at least one coding sequence for said artificial nucleic acid molecule (RNA), and where the amino acid sequence encoded by said artificial nucleic acid (RNA) molecule is preferably not modified in comparison with the amino acid sequence encoded by the corresponding wild-type nucleic acid (RNA). Modified nucleic acid sequences
[00335] [00335] The sequence modifications indicated above can, in general, be applied to any of the nucleic acid (RNA) sequences described herein and are particularly considered to be applied to the coding sequences that comprise or consist of
[00336] Accordingly, in the preferred embodiments, the artificial nucleic acid (RNA) molecules of the invention comprise at least one coding sequence that encodes a (poly) peptide or protein of interest, wherein said coding sequence has been modified as described above.
[00337] [00337] Therefore, in some preferred embodiments, the artificial nucleic acid (RNA) molecules according to the invention comprise at least one element of the 5 'RTU as defined herein, at least one element of the 3' RTU as defined herein and a coding sequence encoding a (poly) peptide or protein of interest, wherein said artificial nucleic acid (RNA) molecule comprises or consists of a nucleic acid sequence according to SEQ ID NO: 50-368 or a variant, fragment or derivative of any one of said sequences, in particular a nucleic acid sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40%, 50% , 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 % or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97% of i sequence identity with any of these
[00338] [00338] According to other preferred embodiments of the invention, a modified artificial nucleic acid (RNA) molecule is modified by the addition of a so-called "5'-Cap", which can preferably stabilize said acid molecule artificial nucleic acid (RNA).
[00339] [00339] A "5-Cap" is an entity, typically a modified nucleotide entity, that generally "limits" the 5 'end of a mature mRNA. A 5 'cap can typically be formed by a modified nucleotide, particularly a derivative of a guanine nucleotide. Preferably, the 5'-cap is connected to the 5 'terminal by means of a 5'-5 "' - triphosphate connection. A 5'-cap can be inserted, for example, m7GpppN, where N is the 5 'terminal nucleotide of the nucleic acid that carries the 5'-cap, typically the 5' end of an mRNA. m7GpppN is the 5'-cap structure, which occurs naturally in the mRNA transcribed by the polymerase | l, therefore, preferably not is considered a "modification" comprised in a modified mRNA in this context. Accordingly, a "modified" artificial nucleic acid (RNA) molecule (or any other nucleic acid, in particular RNA, as defined herein) may comprise a m7GpppN as a 5'-cap, but additionally said modified artificial nucleic acid (RNA) molecule (or other nucleic acid) typically comprises at least one additional modification, as defined herein.
[00340] [00340] “Other examples of 5'cap structures include glycerol, inverted abasic deoxy residue (component), 4 ', 5' methylene nucleotide, 1- (beta-D-erythrofuranosyl) nucleotide, 4'-uncle nucleotide, carbocyclic nucleotide, 1,5-anhydroxytol nucleotide, L nucleotides, alpha nucleotide, modified base nucleotide, treopentofuranosyl nucleotide, 3 ', 4'-dry acyclic nucleotide, 3, 4- acyclic nucleotide dihydroxybutyl, acyclic 3,5-dihydroxypentia nucleotide, components
[00341] [00341] Particularly preferred modified 5'-cap structures are cap1 (ribose methylation of the adjacent nucleotide of m7G), cap2 (additional ribose methylation of the 2nd nucleotide downstream of the m7G), cap3 (additional methylation of the ribose of the 3rd nucleotide downstream) m7G), cap4 (ribose methylation of the 4th nucleotide downstream of m7G), ARCA (antireverse cap analogue), modified ARCA (for example, phosphate-modified ARCA), inosine, Ni-methyl-guanosine, 2'- fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine and 2-azido-guanosine.
[00342] [00342] According to preferred embodiments, the artificial nucleic acid comprises a methyl group at the 2'-O position of the riboose-2'-O position of the first nucleotide adjacent to the cap structure at the 5 'end of the RNA (cap-1) Typically, methylation can be performed by the action of Cap 2'-O-Methyltransferase, using artificial nucleic acids capped with m7GpppN (preferably RNA) as a substrate and S-adenosylmethionine (SAM) as a donor methylation to methylate the capped RNA (cap-0) resulting in the cap-1 structure. The cap-1 structure has been reported to enhance the efficiency of MRNA translation and, therefore, can help improve the expression efficacy of the artificial nucleic acid of the invention, preferably RNA, described here. Pulley)
[00343] [00343] According to other preferred embodiments, the artificial nucleic acid (RNA) molecule of the invention can contain a poly (A) sequence.
[00344] [00344] The term "poly (A) sequence", also called "poly (A) tail" or "3'-poly (A) tail" means an adenosine nucleotide sequence, for example, up to about 400 adenosine nucleotides, for example, from about 20 to about 400, preferably from about 50 to about 400, more preferably from about 50 to about 300, even more preferably from about 50 to about 250 , more preferably from about 60 to about 250 adenosine nucleotides. As used herein, a "poly (A) sequence" can also comprise about 10 to 200 adenosine nucleotides, preferably about 10 to 100 adenosine nucleotides, more preferably about 40 to 80 adenosine nucleotides, or even more preferably about 50 to 70 adenosine nucleotides. A "poly (A) sequence" is typically located at the 3 'end of an RNA, in particular an mRNA.
[00345] Accordingly, in other preferred embodiments, the artificial nucleic acid (RNA) molecule of the invention may contain at its 3 'end a poly (A) tail of typically about 10 to 200 adenosine nucleotides, preferably about 10 to 100 adenosine nucleotides, more preferably about 40 to 80 adenosine nucleotides or even more preferably about 50 to 70 adenosine nucleotides.
[00346] [00346] The poly (A) sequence in the artificial nucleic acid (RNA) molecule can preferably originate from a DNA model through in vitro RNA transcription. Alternatively, the poly (A) sequence can also be obtained in vitro by common methods of chemical synthesis without necessarily being transcribed from a DNA model.
[00347] [00347] Furthermore, "poly (A) strings" or "poly (A) tails"
[00348] Accordingly, the artificial nucleic acid (RNA) molecule of the invention can comprise a polyadenylation signal that transmits polyadenylation to an RNA (transcribed) by specific protein factors (e.g., cleavage specificity and polyadenylation factor (CPSF), cleavage stimulating factor (CstF), cleavage factors | and II (CF | and CF II), poly (A) polymerase (PAP)).
[00349] [00349] In this context, a consensus polyadenylation signal is preferable comprising the NN (U / T) ANA consensus sequence. In a particularly preferred aspect, the polyadenylation signal comprises one of the following sequences: AA (U / T) AMA or A (U / T) (U / T) AAA (where uridine is generally present in RNA and thymidine is usually present in DNA).
[00350] [00350] - According to some modalities, the artificial nucleic acid (RNA) molecule may contain a poly (C) tail at the 3 'terminal of typically about 10 to 200 cytosine nucleotides, preferably about 10 to 100 cytosine nucleotides, more preferably about 20 to 70 cytosine nucleotides or even more preferably about 20 to 60 or even 10 to 40 cytosine nucleotides. Histone pendulular loop (histone SL or HSL)
[00351] [00351] “According to some modalities, the artificial nucleic acid (RNA) molecule may comprise a histone penducular loop sequence / structure. Such histone penducular loop sequences are preferably selected from histone penducular loop sequences as disclosed in WO 2012/019780, the disclosure of which is hereby incorporated by reference.
[00352] [00352] “A histone pendulum loop sequence, suitable for use in the present invention, is preferably selected from at least one of the following formulas (1) or (II): Formula (1) (pendulum loop sequence without bordering elements pendulum): [No-2GN3-5] [No-a (U / T) No-4] [N3-sCNo-2] To o] o A Nom —— pendulum 1 pendulum loop 2 Formula (Il) (sequence pendulular loop with elements bordering the pendulum): Ni1-6 [No-2GN3-5] [No-4 (U / T) No-4] [N3-5CNo-2] Ni-6 AO Ace r— the pendulum element 1 pendulum loop 2 bordering element of border pendulum 2. pendulum 1 where:
[00353] [00353] In accordance with other embodiments, the artificial nucleic acid (RNA) molecule of the invention can comprise at least one pendulum loop sequence of styrene according to at least one of the following specific formulas (la) or (lla): formula (la) (pendulum loop sequence without elements bordering the pendulum): [No-1GN3-5] [N1-3 (U / T) No-2] [N3-5CNo-1] Den aeee Mn Pç io! pendulum 1 loop pendulum 2 formula (lla) (pendulum loop sequence with elements bordering the pendulum): N2-5 [No-1GN3-5] [N1-3 (U / T) No-2] [N3-5CNo-1 ] Na2-5 o AZ o A] DA element - pendulum 1 pendulum 2 - borderline element of aa borderline pendulum 1 pendulum 2 where: N, C, G, T and U are as defined above.
[00354] [00354] According to other embodiments, the artificial nucleic acid (RNA) molecule of the invention may comprise at least one histone pendulum loop sequence according to at least one of the following specific formulas (Ib) or (Ilb): formula (lb) (pendulum loop sequence without elements bordering the pendulum): [N1GN4] [N2 (U / T) N1] [NCN1] pu Au A og— pendulum 1 pendulum loop 2 formula (IIb) (pendulum loop sequence with border elements of the pendulum): Na-5 [N1GN4] [N2 (U / DN1] [N4CN1] Nas O Mg Qu— TA element = pendulum 1 handle pendulum 2 - border element of the border of pendulum 1 pendulum 2 where: N, C , G, Te U are as defined above.
[00355] [00355] A particularly preferred histone pendulum loop sequence is the CAMAGGCTCTTTTCAGAGCCACCA sequence (SEQ ID NO: 37) or more preferably the corresponding RNA sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 38). Buildings
[00356] [00356] The artificial nucleic acid (RNA) molecule of the invention, which comprises at least one element of the 5 'UTR, at least one element of the 3' UTR and, optionally, at least one coding sequence as defined herein, can optionally still comprise at least one pendulum loop of histone, po-Ii (A) and / or poly (C) sequence. The elements can occur in it in any order from 5 'to 3' along the sequence of the artificial nucleic acid (RNA) molecule.
[00357] [00357] In addition, the artificial nucleic acid (RNA) molecule of the invention may comprise other elements, as described herein, such as a stabilizing sequence as defined herein (for example, derived from the UTR of a globin gene), sequences IRES, etc. Each of the elements can also be repeated in the artificial nucleic acid (RNA) molecule of the invention at least once (particularly in di- or multicistronic constructions), for example, two or more. As an example, the individual elements can be present in the artificial nucleic acid (RNA) molecule, preferably RNA, of the invention in the following order:
[00358] [00358] According to other modalities, the artificial nucleic acid (RNA) molecule of the invention can optionally still comprise at least one of the following structural elements: a penducular histone-loop structure, preferably a penducular histone-loop structure in its untranslated region 3 '; a 5'-cap structure; a poly-A tail; and / or a poly (C) sequence.
[00359] [00359] "Specifically, the artificial nucleic acid (RNA) molecules of the invention may comprise, preferably in the 5 'to 3' direction, the following elements: a) a 5-CAP structure, preferably m7GpppN or Cap1 b) a 5-UTR element, which comprises or consists of a nucleic acid sequence, which is derived from a 5-UTR as defined herein, preferably comprising a nucleic acid sequence which corresponds to the nucleic acid sequence according to SEQ ID NO: 1-22 or its counterpart, fragment or variant; c) at least one coding sequence as defined herein; d) a 3'-UTR element, which comprises or consists of a nucleic acid sequence, which is derived from a 3'-UTR as defined herein, preferably comprising a nucleic acid sequence which corresponds to the nucleic acid sequence of according to SEQ ID NO: 23-36, or its counterpart, fragment or variant, e) optionally, a poly (A) tail, preferably consisting of 10 to 1000, 10 to 500, 10 to 300 10 to 200, 10 to 100, 40 to 80 or 50 to 70 adenosine nucleotides, f) optionally, a poly (C) tail, preferably consisting of 10 to 200, 10 to 100, 20 to 70, 20 to 60 or 10 to 40 cytosine nucleotides, eg) optionally, a histone pendulum loop.
[00360] [00360] Preferred artificial nucleic acid constructs are examined in detail below.
[00361] [00361] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an HSD17BA gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a GNAS gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any
[00362] [00362] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an NDUFAA4 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a PSMB3 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 188-193, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences.
[00363] [00363] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an SLC7A3 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a PSMB3 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 313-319, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences. 5 'RTU element derived from NOSIP and 3' RTU element derived from PSMB3:
[00364] [00364] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a NOSIP gene SUTR, or its homolog, fragment, variant or derivative and at least one 3 'UTR element derived from a 3'UTR of a PSMB3 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 229-235, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences.
[00365] [00365] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a NOSIP gene SUTR, or its homolog, fragment, variant or derivative and at least one 3 'UTR element derived from a 3'UTR of a GNAS gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 250-256, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences.
[00366] [00366] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an MP68 gene, or its homolog, fragment, variant or derivative and at least minus one element of the 3 'UTR derived from a 3'UTR of a PSMB3 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 145-151, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences.
[00367] [00367] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an MP68 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a CASP1 gene, or its homolog, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 152-158, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences.
[00368] [00368] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an MP68 gene, or its homolog, fragment, variant or derivative and at least minus one element of the 3 'UTR derived from a 3'UTR of a GNAS gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 166-172, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences.
[00369] [00369] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of a UBQLN 2 gene, or its homolog, fragment, variant or derivative and at least one element of the 3 'UTR derived from a 3'UTR of an RPS9 gene, or its homolog, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 362-368, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences. 5 'RTU element derived from ASAH1 and 3' RTU element derived from RPS9:
[00370] [00370] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an ASAH1 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of an RPS9 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 96-102, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences.
[00371] [00371] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an HSD17BA gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of an RPS9 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 89-95, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences.
[00372] [00372] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an HSD17BA gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a CASP1 gene, or its homolog, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any one of SEQ ID NOs: 61-67, or its homolog, variant, fragment or derivative , in particular a nucleic acid sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86% , 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences .
[00373] [00373] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a NOSIP gene SUTR, or its homolog, fragment, variant or derivative and at least one 3 'UTR element derived from a 3'UTR of a COX6B1 gene, or its homolog, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID Nos: 243-249, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences. 5 'RTU element derived from NDUFA4 and 3' RTU element derived from RPS9:
[00374] [00374] In some preferred embodiments, the artificial nucleic acids according to the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an NDUFAA4 gene, or its homolog, fragment, variant or derivative and at least an element of the 3 'UTR derived from a 3'UTR of an RPS9 gene, or its homolog, fragment, variant or derivative, wherein said artificial nucleic acid comprises or consists of a nucleic acid sequence according to any one SEQ ID NOs: 222-228, or its counterpart, variant, fragment or derivative, in particular a nucleic acid sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% , 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferable - at least 95% or even 97%, of sequence identity with any of these sequences. 5 'RTU element derived from NOSIP and 3' RTU element derived from
[00375] [00375] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a NOSIP gene SUTR, or its homolog, fragment, variant or derivative and at least one 3 'UTR element derived from a 3'UTR of an NDUFA1 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 257-263, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences. 5 'RTU element derived from NDUFA4 and 3' RTU element derived from COX6B1:
[00376] [00376] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an NDUFAA4 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a COX6B1 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 201-207, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences. 5 'RTU element derived from NDUFA4 and 3' RTU element derived from NDUFA1:
[00377] [00377] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an NDUFAA4 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of an NDUFA1 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 215-221, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences. 5 'RTU element derived from ATP5A1 and 3' RTU element derived from CASP1:
[00378] [00378] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an ATP5A1 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a CASP1 gene, or its homolog, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 110-116, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences. 5 'RTU element derived from SLC7A3 and 3' RTU element derived from GNAS:
[00379] [00379] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an SLC7A3 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a GNAS gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 334-340, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,
[00380] [00380] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an HSD17BA gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of an NDUFA1 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any one of SEQ ID NOs: 82-88, or its homolog, variant, fragment or derivative , in particular a nucleic acid sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86% , 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences . 5 'RTU element derived from SLC7A3 and 3' RTU element derived from NDUFA1:
[00381] [00381] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an SLC7A3 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of an NDUFA1 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 341-347, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences.
[00382] [00382] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an SLC7A3 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of an RPS9 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 348-354, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,
[00383] [00383] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5 UTR of a TUBBA4B gene, or its homolog, fragment, variant or derivative and at least a 3 'UTR element derived from a 3'UTR of an RPS9 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 355-361, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences. 5 'RTU element derived from RPL31 and 3' RTU element derived from RPS9:
[00384] [00384] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5 UTR of an RPL31 gene, or its homolog, fragment, variant or derivative and at least a 3 'UTR element derived from a 3'UTR of an RPS9 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 306-312, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences.
[00385] [00385] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an MP68 gene, or its homolog, fragment, variant or derivative and at least minus one element of the 3 'UTR derived from a 3'UTR of an RPS9 gene, or its homolog, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 180-187, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,
[00386] [00386] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a NOSIP gene SUTR, or its homolog, fragment, variant or derivative and at least one 3 'UTR element derived from a 3'UTR of an RPS9 gene, or its homolog, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 264-270, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences. 5 'RTU element derived from ATP5A1 and 3' RTU element derived from RPS9:
[00387] [00387] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an ATP5A1 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of an RPS9 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 138-144, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences.
[00388] [00388] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an ATP5A1 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a COX6B1 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 117-123, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,
[00389] [00389] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an ATP5A1 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a GNAS1 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 124-130, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences. 5 'RTU element derived from ATP5A1 and 3' RTU element derived from NDUFA1:
[00390] [00390] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an ATP5A1 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of an NDUFA1 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 131-137, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences.
[00391] [00391] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an ATP5A1 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a PSMB3 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 103-109, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,
[00392] [00392] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an HSD17BA gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a COXG6B1 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any one of SEQ ID NOs: 68-74, or its homolog, variant, fragment or derivative , in particular a nucleic acid sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86% , 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences . 5 'RTU element derived from HSD17B4 and 3' RTU element derived from GNAS1:
[00393] [00393] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an HSD17BA gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a GNAS1 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any one of SEQ ID NOs: 75-81, or its homolog, variant, fragment or derivative , in particular a nucleic acid sequence having, in increasing order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86% , 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80%, even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences .
[00394] [00394] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an MP68 gene, or its homolog, fragment, variant or derivative and at least minus one element of the 3 'UTR derived from a 3'UTR of a COX6B1 gene, or its homolog, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 159-165, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,
[00395] [00395] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an MP68 gene, or its homolog, fragment, variant or derivative and at least minus one element of the 3 'UTR derived from a 3'UTR of an NDUFA1 gene, or its homolog, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 173-179, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences. 5 'RTU element derived from NDUFA4 and 3' RTU element derived from CASP1:
[00396] [00396] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an NDUFAA4 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a CASP1 gene, or its homolog, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 194-200, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences.
[00397] [00397] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an NDUFAA4 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a GNAS1 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 208-214, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,
[00398] [00398] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a NOSIP gene SUTR, or its homolog, fragment, variant or derivative and at least one 3 'UTR element derived from a 3'UTR of a CASP1 gene, or its homolog, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 236-242, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences. 5 'RTU element derived from RPL31 and 3' RTU element derived from CASP1:
[00399] [00399] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5 UTR of an RPL31 gene, or its homolog, fragment, variant or derivative and at least a 3 'UTR element derived from a 3'UTR of a CASP1 gene, or its homolog, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 278-284, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences.
[00400] [00400] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5 UTR of an RPL31 gene, or its homolog, fragment, variant or derivative and at least a 3 'UTR element derived from a 3'UTR of a COX6B1 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 285-291, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,
[00401] [00401] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5 UTR of an RPL31 gene, or its homolog, fragment, variant or derivative and at least a 3 'UTR element derived from a 3'UTR of a GNAS1 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 292-298, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences. 5 'RTU element derived from RPL31 and 3' RTU element derived from NDUFA1:
[00402] [00402] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5 UTR of an RPL31 gene, or its homolog, fragment, variant or derivative and at least a 3 'UTR element derived from a 3'UTR of an NDUFA1 gene, or its homolog, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 299-305, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences.
[00403] [00403] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an SLC7A3 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a CASP1 gene, or its homolog, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 320-326, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,
[00404] [00404] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5'UTR of an SLC7A3 gene, or its homolog, fragment, variant or derivative and at least at least one element of the 3 'UTR derived from a 3'UTR of a COX6B1 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 327-333, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences. 5 'RTU element derived from RPL31 and 3' RTU element derived from PSMB3:
[00405] [00405] In some preferred embodiments, artificial nucleic acid (RNA) molecules of the invention comprise at least one element of the 5 'UTR derived from a 5 UTR of an RPL31 gene, or its homolog, fragment, variant or derivative and at least an element of the 3 'UTR derived from a 3'UTR of a PSMB3 gene, or its counterpart, fragment, variant or derivative; wherein said artificial nucleic acid (RNA) molecule preferably comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 271-277, or its homolog, variant, fragment or derivative, in particular a nucleic acid sequence having, in ascending order of preference, at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, preferably at least 70%, more preferably at least 80% , even more preferably at least 85%, even more preferably at least 90% and most preferably at least 95% or even 97%, of sequence identity with any of these sequences. Complexation
[00406] [00406] In preferred embodiments, at least one artificial nucleic acid (RNA) molecule of the invention can be supplied in a complexed form, that is, complexed or associated with one or more (poly) cationic compounds, preferably with polymers (polysaccharides). li) cationic, peptides or (poly) cationic proteins, for example, protamine, (poly) cationic polysaccharides and / or (poly) cationic lipids. In this context, the terms "complexed" or "associated" refer to the essentially stable combination of at least one artificial nucleic acid (RNA) molecule with one or more of the compounds mentioned above in larger complexes or assemblies, typically with no covalent bond. . Lipids
[00407] [00407] According to preferred embodiments, the artificial nucleic acid (RNA) molecule of the invention is complexed or associated with lipids (in particular cationic and / or neutral lipids) to form one or more liposomes, lipoplexes, lipid nanoparticles or nanoli - we can.
[00408] [00408] Therefore, in some embodiments, the artificial nucleic acid (RNA) molecule of the invention can be supplied in the form of a lipid-based formulation, in particular in the form of liposomes, lipoplexes and / or lipid nanoparticles comprising referred to the artificial nucleic acid (RNA) molecule. Lipid nanoparticles
[00409] [00409] “According to some preferred modalities, the artificial nucleic acid (RNA) molecule of the invention is complexed or associated with lipids (in particular cationic and / or neutral lipids) to form one or more nanoparticles lipids.
[00410] [00410] Preferably, lipid nanoparticles (LNPs) may comprise: (a) at least one artificial nucleic acid (RNA) molecule of the invention, (b) a cationic lipid, (c) an aggregation reducing agent (such as lipid polyethylene glycol (PEG) or PEG modified lipid), (d) optionally a non-cationic lipid (such as a neutral lipid) and (e) optionally, a sterol.
[00411] [00411] In some embodiments, LNPs may comprise, in addition to at least one artificial nucleic acid (RNA) molecule of the invention, (i) at least one cationic lipid; (ii) a neutral lipid; (iii) a sterol, for example, cholesterol; and (iv) a PEG lipid, in a molar ratio of about 20 to 60% cationic lipid: 5 to 25% neutral lipid: 25 to 55% sterol; 0.5 to 15% PEG lipid.
[00412] [00412] In some embodiments, the artificial nucleic acid (RNA) molecule of the invention can be formulated into an amino alcohol lipid. The amino alcohol lipidoids, which can be used in the present invention, can be prepared by the methods described in U.S. Patent No. 8,450,298, incorporated herein by reference in their entirety. (1) Cationic lipids
[00413] [00413] LNPs can include any suitable cationic lipid to form a lipid nanoparticle. Preferably, the cationic lipid carries a net positive charge around the physiological pH.
[00414] [00414] The cationic lipid can be an amino lipid. As used herein, the term "amino lipid" should include those lipids that have one or two chains of fatty acids or fatty alkyl and a separate amino group (including an alkylamino or dialkylamino group) that can be protonated to form a cationic lipid at physiological pH.
[00415] [00415] The cationic lipid can be, for example, N, N-dioleyl-N, N-dimethylammonium chloride (DODAC), N-distearyl-N, N-dimethylammonium bromide (DDAB), 1-chloride , 2-dioleoyltrimethyl ammonium propane (DOTAP) (also known as N- (2,3-dioleoyloxy) propyl chloride) -N, N N-trimethylammonium and 1,2-Dioleyloxy-3-trimethylamino chloride salt nopropane), N- (1- (2,3-dioleyloxy) propyl) -N, N N-trimethylammonium (DOTMA), N, N-dimethyl-2,3-dioleyloxy) propylamine (DODMA), 1,2 -DiLino-leyloxy-N, N-dimethylaminopropane (DLInDMA), 1,2-Dilinolenyloxy-N, N-dimethylaminopropane (DLenDMA), 1,2-diylinolenyloxy-N N-dimethylamino-propane (y-DLenDMA), 1 , 2-Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleioxy-3- (dimethylamino) acetoxypropane (DLin-DAC), 1,2-Dilinoleioxy-3-morpholinopropane (DLin-MA) , 1,2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-Dilinoleylthio-3-dimethyl-minopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleyloxy-3-dimethylamino-propane (DLin -2-DMAP), salt 1,2-Dilinoleyloxy-3-trimethylminopropane chloride (DLin-TMA.CI), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.CI), 1,2-Dilinoleyloxy -3- (N-methylpiperazine) propane (DLin-MPZ), or 3- (N, N-Dilinoleylamino) -1,2-propanediol (DLi-
[00416] [00416] Other suitable cationic lipids include, but are not limited to, N N-distearyl-N N-dimethylammonium bromide (DDAB), 3P- (N- (N 'N'-dimethylaminoethane) -carbamoyl) cholesterol (DC -Chol), N- (1I- (2,3-dioleyloxy) propyl) -N-2- (sperminecarboxamido) ethyl) -N, N-dimethylammonium (DOSPA), dioctadecylamidoglycyl carboxiespermin (DOGS), trifluoro-racetate, 1,2-dileoyl-sn-3-phosphoethanolamine (DOPE), 1,2-dioleoyl-3-dimethylammonium propane (DODAP), N- (1,2-dimyristyloxyprop-3-yl) bromide -N, N- dimethyl-N-hydroxyethyl ammonium (DMRIE), and 2,2-Dilinoleyl-4-dimethylaminoethyl- [1,3] -dioxolane (XKTC). In addition, commercial cationic lipid preparations, such as, for example, LIPOFECTIN (including DOTMA and DOPE, available from GIBCO / BRL) and LIPOFECTAMINE (comprising DOSPA and DOPE, available from GIBCO / BRL) can be used.
[00417] [00417] Other suitable cationic lipids are disclosed in International Publications Nos. WO 09/086558, WO 09/127060, WO
[00418] [00418] Other suitable lipid amino acids include those having alternative fatty acid groups and other dialkylamino groups, including those in which the alkyl substituents are different (for example, N-ethyl-N-methylamino- and N-propyl-N -ethylamino-). In general, lipid amino acids with less saturated acyl chains are more easily sized, particularly when complexes must be sized below about 0.3 microns, for filter sterilization purposes. Amino lipids containing unsaturated fatty acids with carbon chain lengths in the range of C14 to C22 can be used. Other matrices can also be used to separate the amino group and the fatty acid or alkyl fatty part of the amino lipid.
[00419] [00419] In another preferred embodiment, the LNP comprises the cationic lipid with formula (III) according to the patent application PCT / EP2017 / 064066. In this context, the disclosure of PCT EP2017 / 064066 is also incorporated here by reference.
[00420] [00420] In some embodiments, the amino or cationic lipids have at least one protonable or deprotonable group, such that the lipid is positively charged at a pH nol or below the physiological pH (for example, pH 7.4 ) and neutral in a second pH, preferably at or above the physiological pH. Obviously, it will be understood that the addition or removal of protons as a function of pH is a balancing process and that the reference to a charged or neutral lipid refers to the nature of the predominant species and does not require that the entire lipid be present in charged or neutral form. Lipids that have more than one protonable or deprotonable group,
[00421] [00421] In some embodiments, the protonable lipids have a pKa of the protonable group in the range of about 4 to about 11, for example, a pKa of about 5 to about 7.
[00422] [00422] LNPs can include two or more cationic lipids. Cationic lipids can be selected to contribute with different advantageous properties. For example, cationic lipids that differ in properties such as pKa amine, chemical stability, circulating half-life, tissue half-life, liquid tissue accumulation or toxicity can be used in LNP. In particular, cationic lipids can be selected so that the properties of the mixed LNP are more desirable than the properties of an LNP isolated from individual lipids.
[00423] [00423] In some embodiments, the cationic lipid is present in a ratio of about 20 mol% to about 70 or 75 mol% or about 45 to about 65 mol% or about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or about 70 mol% of the total lipid present in the LNP. In other embodiments, LNPs comprise from about 25% to about 75% on a cationic lipid molar basis, for example, from about 20 to about 70%, from about 35 to about 65%, from about from 45 to about 65%, around 60%, around 50% or around 40% on a molar basis (based on 100% of total moles of lipid in the lipid nanoparticle). In some embodiments, the ratio of cationic lipid to nucleic acid is about 3 to about 15, such as about 5 to about 13 or about 7 to about 11.
[00424] [00424] In some embodiments, the liposome may have a molar ratio of nitrogen atoms in the cationic lipid and phosphates in the RNA (N: P ratio) between 1: 1 and 20: 1, as described in International Publication No. WO 2013/006825 A1, hereby incorporated by reference
[00425] [00425] The "non-cationic lipid" can be a neutral lipid, an anionic lipid or an amphipathic lipid.
[00426] [00426] Neutral lipids can be any one of a number of lipid species that exist in an uncharged or neutral zwitterionic form at physiological pH. Such lipids include, for example, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, dihydrosphingomyelin, cephaline and cerebrosides. The selection of neutral lipids for use in the LNPs described here is generally guided by the consideration of, for example, LNP size and LNP stability in the bloodstream. Preferably, the neutral lipid may be a lipid with two acyl groups (for example, diacylphosphatidylcholine and diacylphosphatidylethanolamine).
[00427] [00427] In some embodiments, neutral lipids contain saturated fatty acids with lengths of carbon chain in the Cio to C2xo range. In other modalities, neutral lipids with mono- or di-unsaturated fatty acids with carbon chain lengths in the Cio to Cao range are used. In addition, neutral lipids with mixtures of saturated and unsaturated fatty acid chains can be used.
[00428] [00428] Suitable neutral lipids include, but are not limited to, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), diphosphylidyl (DEPG), dipalm palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoylphosphatidylethanolamine 4- (N-maleimido-methyl) -cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl-ethanol-dimethoxy-ethanol-ethylamine -
[00429] [00429] "" Amphipathic lipid "means any suitable material, in which the hydrophobic part of a lipid material is oriented towards a hydrophobic phase, while the hydrophilic part is oriented towards the aqueous phase. Such compounds include, but are not limited to, phospholipids, aminolipids and sphingolipids. Representative phospholipids include sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidyl serine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylamine, dylaminephylamine, dylmythylylamine, dylamine Other compounds without phosphorus, such as sphingolipids, families of glycosphingolipids, diacylglycerols and beta-acyloxy acids, can also be used.
[00430] [00430] In some embodiments, non-cationic lipid may be present in a ratio of about 5 mol% to about 90 mol%, about 5 mol% to about 10 mol%, about 5, 10.15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85 or about 90 mol% of the total lipid present in the LNP.
[00431] [00431] In some embodiments, LNPs comprise from about 0% to about 15 or 45% on a neutral lipid molar basis, for example, from about 3 to about 12% or from about 5 to about 10%. For example, LNPs can include around 15%, around 10%, around 7.5% or around 7.1% of neutral lipids on a molar basis (based on 100% of total moles of lipids in LNP). iji) Sterols
[00432] [00432] Sterol may preferably be cholesterol.
[00433] [00433] Sterol can be present in a ratio of about 10 mol% to about 60 mol% or about 25 mol% to about 40 mol% of LNP. In some embodiments, sterol is present in a ratio of about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 or about 60 mol% of the total lipid present in the LNP. In other modalities, LNPs comprise from about 5% to about 50% on a molar basis of sterol, for example, about 15% to about 45%, about 20% to about 40%, when around 48%, around 40%, around 38.5%, around 35%, around 34.4%, around 31.5% or around 31% in a molar base (based on 100% mol total lipid in LNP). (iv) Aggregation reducing agents
[00434] [00434] The aggregation-reducing agent can be a lipid capable of reducing aggregation.
[00435] [00435] “Examples of such lipids include, but are not limited to, lipids modified with polyethylene glycol (PEG), monosial-ganglioside Gml and polyamide oligomers (PAO) such as those described in US Patent No. 6,320,017, which is incorporated by reference in its entirety. Other compounds with non-loaded, hydrophilic, steric barrier components that prevent aggregation during formulation, such as PEG, Gml or ATTA, can also be coupled to lipids. ATTA lipids are described, for example, in U.S. Patent No. 6,320,017, and PEG-lipid conjugates are described, for example, in U.S. Patent Nos. 5,820,873, 5,534,499 and
[00436] [00436] The aggregation-reducing agent can, for example, be selected from a polyethylene glycol (PEG) lipid, including, without limitation, a PEG-diacylglycerol (DAG), a PEG-dialkylglycerol, a PEG- dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer) or a mixture thereof (such as PEG-Cerl4 or PEG-Cer20). The PEG-DAA conjugate can be, for example, a PEG-dilauryloxypropyl (C14), a PEG-dimyristyloxypropyl (C14), a PEG-dipalmityloxypropyl (C16) or a PEG-distearyloxypropyl (C18). Other pegylated lipids include, but are not limited to, polyethylene glycol-didimiristoyl glycerol (C14-PEG or PEG-C14, where PEG has an average molecular weight of 2000 Da) (PEG-DMG); (R) -2,3-bis (octadecyloxy) propyl-1- (methoxypol (ethylene glycol |) 2000) propylcarbamate) (PEG-DSG); PEG-carbamoyl-1,2-dimyristyloxypropylamine, where PEG has an average molecular weight of 2000 Da (PEG-cDMA); N- Acetylgalactosamine - ((R) -2,3-bis (octadecyloxy) propyl-1- (methoxypoly (ethylene glycol) 2000) propylcarbamate)) (GalNAc-PEG-DSG); mPEG (mw2000) -diastearoylphosphatidyl-ethanolamine (PEG-DSPE); and polyethylene glycol-dipalmitoylglycerol (PEG-DPG).
[00437] [00437] In some embodiments, the aggregation reducing agent is PEG-DMG. In other embodiments, the aggregation reducing agent is PEG-c-DMA.
[00438] [00438] In other preferred embodiments, LNP comprises lipid-PEG alternatives, is less PEG and / or comprises phosphatidylcholine (PC) replacement lipids (eg oleic acid or its analogs).
[00439] [00439] In other preferred embodiments, the LNP comprises the aggregation reducing agent with formula (IV) according to patent application POT / EP2017 / 064066. Composition of LNP
[00440] [00440] The composition of LNPs can be influenced, inter alia, by
[00441] [00441] In some embodiments, LNPs may comprise from about 35 to about 45% of cationic lipids, from about 40% to about 50% of cationic lipids, from about 50% to about 60% of lipids cationic and / or about 55% to about 65% cationic lipids. In some embodiments, the lipid to nucleic acid ratio can range from about 5: 1 to about 20: 1, from about 10: 1 to about 25: 1, from about 15: 1 to about 30: 1 and / or at least 30: 1.
[00442] [00442] The average molecular weight of the PEG component in PEG modified lipids can vary from about 500 to about
[00443] [00443] The concentration of the aggregation reducing agent can vary from about 0.1 to about 15 mol%, per 100 mol% of total lipid in the LNP. In some embodiments, LNPs include less than about 3, 2 or 1 mole percent of PEG lipid or modified by PEG, based on the total mole of lipid in the LNP. In other embodiments, LNPs comprise from about 0.1% to about 20% of PEG-modified lipid on a molar basis, for example, about 0.5 to about 10%, about 0 , 5 to about 5%, about 0.5% to about 5%, around 10%, around 5%, around 3.5%, around 1.5%, around 0.5% or around 0.3% on a molar basis (based on 100 mol% of total lipids in LNP).
[00444] [00444] Different LNPs with variable molar ratios of cationic lipid, non-cationic (or neutral lipid), sterol (eg cholesterol) and aggregation reducing agent (such as a PEG modified lipid) on a molar basis (with based on the total mole of lipid in the lipid nanoparticles), as shown in Table 3 below. In preferred embodiments, the lipid nanoparticle formulation of the invention essentially consists of a lipid mixture in molar ratios of about 20 to 70% cationic lipid: 5 to 45% neutral lipid: 20 to 55% cholesterol, 0, 5 to 15% PEG-modified lipid, more preferably at molar ratios of about 20 to 60% cationic lipid: 5 to 25% neutral lipid: 25 to 55% cholesterol: 0.5 to 15% PEG modified lipid.
[00445] [00445] In some modalities, LNPs can occur as liposomes or lipoplexes, as described in more detail below.
[00446] [00446] In some embodiments, LNPs have an average diameter size of about 50 nm to about 300 nm, such as from about 50 nm to about 250 nm, for example, from about 50 nm to about 200 nm.
[00447] [00447] In some modalities, smaller LNPs can be used. Such particles may comprise a diameter below 0.1 µm to 100 nm, such as, but not limited to, less than 0.1 µm, less than 1.0 µm, less than 5 µm, less than 10 μm, less than 15 μm, less than 20 μm, less than 25 μm, less than 30 μm, less than 35 μm, less than 40 μm, less than 50 μm, less than 55 um, less than 60 um, less than 65 um, less than 70 um, less than 75 um, less than 80 um, less than 85 um, less than 90 um, less than 95 um less than 100 um, less than 125 um, less than 150 um, less than 175 um, less than 200 um, less than 225 um, less than 250 um, less than 275 um, less than 300 um, less than 325 um, less than 350 um, less than 375 um, less than 400 um, less than 425 um, less than 450 um, less than 475 um, less than 500 um, less than 525 um, less than 550 um, less than 575 um, less than 600 um, less than 625 um, less than 650 um, less or less than 675 um, less than 700 um, less than 725 um, less than 750 um, less than 775 um, less than 800 um, less than 825 um, less than 850 um, less than than 875 μm, less than 900 μm, less than 925 μm, less than 950 μm, less than 975 μm, In another embodiment, nucleic acids can be released
[00448] [00448] In some embodiments, the LNP has a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, greater than 950 nm or greater than 1000 nm.
[00449] [00449] In other modalities, LNPs have a particle size distribution in a unique way (that is, they are not bi or polymodal).
[00450] [00450] LNPs may also comprise one or more lipids and / or other components in addition to those mentioned above.
[00451] [00451] - Other lipids can be included in the liposome compositions for a variety of purposes, such as to prevent lipid oxidation or to bind ligands on the liposome surface. Any of several lipids can be present in LNP's, including amphipathic, neutral, cationic and anionic lipids. Such lipids can be used alone or in combination.
[00452] [00452] - Additional components that may be present in an LNP include bilayer stabilizing components, such as polyamide oligomers (see, for example, U.S. Patent No.
[00453] [00453] In some embodiments, the artificial nucleic acid (RNA) molecules of the invention are formulated as liposomes.
[00454] [00454] Liposomes based on cationic lipids are capable of complexing with negatively charged nucleic acids (for example, RNAs) through electrostatic interactions, resulting in complexes that offer biocompatibility, low toxicity and the possibility of large-scale production required for in vivo clinical applications. Liposomes can fuse with the plasma membrane for uptake; once inside the cell, the liposomes are processed via the endocytic pathway and the nucleic acid is then released from the endosome / vehicle into the cytoplasm. Liposomes have long been seen as drug delivery vehicles due to their superior biocompatibility, assuming that liposomes are basically analogous to biological membranes and can be prepared from natural and synthetic phospholipids (Int JNanomedicine. 2014; 9: 1833 -1843).
[00455] [00455] Liposomes can typically consist of a lipid bilayer that can be composed of cationic, anionic or neutral (phospho) lipids and cholesterol, which contains an aqueous nucleus. Both the lipid bilayer and the aqueous space can incorporate hydrophobic or hydrophilic compounds, respectively. Liposomes can have one or more lipid membranes. Liposomes can be single-layer, called unilamellar, or of multiple layers, called multilamellar.
[00456] [00456] The characteristics and behavior of liposomes in vivo can be modified by adding a hydrophilic polymer coating, for example, polyethylene glycol (PEG), to the surface of the liposome to confer steric stabilization. In addition, liposomes can be used for specific targeting by binding ligands (for example, antibodies, peptides and carbohydrates) to their surface or to the terminal end of the linked PEG chains (Front Pharmacol. 2015 Dec 1; 6: 286).
[00457] [00457] Liposomes can typically present as spherical vehicles and can vary in size from 20 nm to a few microns.
[00458] [00458] Liposomes can have different sizes such as, but are not limited to, a multilamellar vesicle (MLV) that can be hundreds of nanometers in diameter and can contain a series of concentric bilayers separated by narrow aqueous compartments, a small vesicle unicellular (SUV) that can be less than 50 nm in diameter and a large unilamellar vesicle (LUV) that can be between 50 and 500 nm in diameter. The design of liposomes may include, but is not limited to, opsonins or ligands, in order to improve the binding of liposomes to unhealthy tissues or to activate events such as, but not limited to, endocytosis. The i-pods can contain a low or high pH in order to improve the release of pharmaceutical formulations.
[00459] [00459] As a non-limiting example, liposomes such as synthetic membrane vehicles can be prepared by the methods, mechanisms and devices described in US Patent Publications Nos. US20130177638, US20130177637, US20130177636, US2013 0177635, US20130177634, US20130177633, US20130183375, US 20130183375, US20130183373, US20130183375, US20130183373, the contents of which are each incorporated herein by reference in their entirety. At least one artificial nucleic acid (RNA) molecule of the invention can be encapsulated by the liposome and / or it can be contained in an aqueous nucleus which can then be encapsulated by the liposome (see Pub. International Nos. WO2012031046, WO 2012039043, WO2012030901 and WO2012030901 and WO2012006378 and US Patent Publications Nos. US20130189351, US20130195969 and US20130202684; the contents of which are each incorporated herein by reference in their entirety).
[00460] [00460] In some embodiments, the artificial nucleic acid (RNA) molecule of the invention can be formulated into liposomes such as, but not limited to, DiLa2 liposomes (Marina Biotech, Bothell, WA), SMARTICLESO (Marina Biotech, Bothell, WA), neutral DOPC-based liposomes (| 1,2-dioleoyl-sn-glycero-3-phosphocholine) (eg, siRNA release for ovarian cancer (Landen et al. Cancer Biology & Therapy 2006 5 ( 12) 1708-1713); incorporated herein by reference in its entirety) and hyaluronan coated liposomes (Quiet Therapeutics, Israel).
[00461] [00461] In some embodiments, the artificial nucleic acid (RNA) molecules of the invention are formulated as lipoplexes, that is, cationic lipid bilayers interspersed between the nucleic acid layers.
[00462] [00462] —Cationic lipids, such as DOTAP, (1,2-dioleoyl-3-trimethylammonium-propane) and DOTMA (N- [1- (2,3-dioleoyloxy) propyl] -N, N N-trime - ammonium til-methyl sulfate) can form complexes or lipoplexes with negatively charged nucleic acids to form nanoparticles by electrostatic interaction, providing high in vitro transfection efficiency. Nanoliposomes
[00463] [00463] In some embodiments, the artificial nucleic acid (RNA) molecules of the invention are formulated as nanoliposomes based on neutral lipids, such as nanoliposomes based on 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC) (Adv Drug Deliv Rev. 2014 Feb; 66: 110-116.). Emulsions
[00464] [00464] In some embodiments, the artificial nucleic acid (RNA) molecules of the invention are formulated as emulsions. In another embodiment, said artificial nucleic acid (RNA) molecules are formulated in a cationic oil-in-water emulsion where the emulsion particle comprises an oil core and a cationic lipid that can interact with the nucleic acids that anchor the molecule in the emulsion particle (see International Pub. No. WO2012 006380; incorporated herein by reference in its entirety). In some embodiments, said artificial nucleic acid (RNA) molecules are formulated into a water-in-oil emulsion comprising a continuous hydrophobic phase in which the hydrophilic phase is dispersed. As a non-limiting example, the emulsion can be made by the methods described in International Publication No. WO201087791, the content of which is incorporated herein by reference in its entirety. (Poly) Cationic Compounds and Vehicles
[00465] [00465] In the preferred embodiments, the artificial nucleic acid (RNA) molecules of the invention are complexed or associated with a cationic or polycationic compound ("(poly) cationic compound") and / or a polymeric vehicle.
[00466] [00466] The term "(poly) cationic compound" typically refers to a charged molecule, which is positively charged (cation) at a pH value typically from 1 to 9, preferably at a pH value of or below 9 ( for example, from 5 to 9), from or below 8 (for example, from 5 to 8), from or below 7 (for example, from 5 to 7), more preferably at a physiological pH, for example of 7 , 3 to 7.4.
[00467] [00467] Accordingly, a "(poly) cationic compound" can be any positively charged compound or polymer, preferably a cationic peptide or protein, which is positively charged under physiological conditions, particularly under physiological conditions in vivo. . A "(poly) cationic peptide or protein" may contain at least one positively charged amino acid or more than one positively charged amino acid, for example, selected from Arg, His, Lys or Orn. Amino acids, peptides and (poly) cationic proteins
[00468] [00468] The (poly) cationic compounds that are particularly preferred agents for complexing or associating artificial nucleic acid (RNA) molecules of the invention include protamine, nucleoline, sperm or spermidine, or other cationic peptides or proteins , such as poly-L-lysine (PLL), polyarginine, basic polypeptides, cell-penetrating peptides (CPPs), including HIV-binding peptides, HIV-1 Tat (HIV), peptides derived from Tat, Penetrin , peptides derived from VP22 or analogues, HSV VP22 (Herpes simplex), MAP, KALA or protein transduction domains (PTDs), PpT620, proline-rich peptides, arginine-rich peptides, lysine-rich peptides, MPG peptides, Pep-1, L-oligomeres, calcitonin peptides, peptides derived from Antennapedia (particularly from Drosophila antennapedia), pAntp, plsl, FGF, Lactoferrin, Trans-tan, Buforin-2, Bac7 15-24, SynB, SynB (1) , pVEC, peptides derived from hCT, SAP or histones.
[00469] [00469] - Preferably, the artificial nucleic acid (RNA) molecule of the invention can be complexed with one or more (poly) cations, preferably with protamine or oligofectamine (discussed below), more preferably with protamine.
[00470] [00470] Other preferred (poly) cationic proteins or peptides can be selected from the following proteins or peptides according to the following formula (Ill): (Arg) (Lis) m; (His) n; (Orn) o; (Xaa ) x, (formula (I11)) where l + m + n + o + x = 8-15el, m, or other independently of each other can be any number selected from 0, 1, 2,3,4,5,6 , 7, 8 9, 10, 11, 12, 13, 14 or 15, as long as the total content of Arg, Lys, His and Orn represents at least 50% of all the oligopeptide amino acids; and Xaa can be any amino acid selected from native (= naturally occurring) or non-native amino acids, except Arg, Lys, His or Orn; and x can be any selected number of O, 1,2, 3 or 4, as long as the total content of Xaa does not exceed 50% of all oligopeptide amino acids. The cationic peptides particularly preferred in this context are, for example, Argz7, Args, Args, H3R9, RoH3a, HaRaH3, YSSRaSSY, (RKH) a, Y (RKH) 2R, etc. In this context, the disclosure of WO 2009/030481 is hereby incorporated by reference. Cationic (poly) polysaccharides
[00471] [00471] Other preferred (poly) cationic compounds to complement
[00472] [00472] Other preferred (poly) cationic compounds for complexing or associating with artificial nucleic acid (RNA) molecules of the invention include (poly) cationic lipids, for example, DOTMA: [1- (2,3-sioleyloxy chloride) ) propyl)] - N, N, N-trimethylammonium, DMRIE, di- C14-amidine, DOTIM, SAINT, DC-Chol, BGTC, CTAP, DOPC, DODAP, DOPE: Dioleyl phosphatidylethanol-amine, DOSPA, DODAB, DOIC, DMEPC, DOGS: Dioctadecylamidoglycylspermine, DIMRI: dimiristooxypropyl dimethyl hydroxyethyl ammonium bromide, DOTAP: dioleoyloxy-3- (trimethylammonium) propane, DC-6-14: O, O-ditetradecanyl-N-chloride (alpha - mononacetyl) diethanolamine, CLIP1: rac chloride - [(2,3-dioctadecyloxy-propyl) (2-hydroxyethyl)] - dimethylammonium, CLIP6: rac- [2 (2,3-diexadecyloxypro-pil-oxymethyloxy) ethyl] trimethylammonium , CLIP9: rac- [2 (2,3-diexadecyloxypropyl-oxysuccinyloxy) ethyl]-trimethylammonium, or oligofectamine. (Poly) Cationic Polymers
[00473] [00473] “Other preferred (poly) cationic compounds for complexing or associating with artificial nucleic acid (RNA) molecules of the invention include (poly) cationic polymers, for example, modified polyamino acids, such as beta-amino acid polymers or reverse polyamides, etc., modified polyethylenes, such as PVP (N-ethyl-4-vinylpyridinium polybromide), etc., modified acrylates, such as pDMAEMA (poly (dimethylaminoethyl methacrylate)), etc. , modified starch-amines, such as pAMAM (poly (amidoamine)), etc., modified poly-betaaminoester (PBAE), such as 1,4-butanediol diacrylate-co-5-amino-1-pentanol polymers diamine end etc., dendrimers, such as polypropylamine dendrimers or pAMAM-based dendrimers, etc., polyimines, such as PEI: polyethyleneimine), poly (propyleneimine), etc., polyalylamine, polymers based on the main chain sugar, such as cyclodextrin-based polymers, polymers based on and dextran, chitosan, etc., polymers based on the silane backbone, such as PMOXA-PDMS copolymers, etc. or block polymers that consist of a combination of one or more cationic blocks (for example, selected from a cationic polymer as mentioned above) and one or more hydrophilic or hydrophobic blocks (for example, polyethylene glycol). Polymeric vehicles
[00474] [00474] According to preferred embodiments, the artificial nucleic acid (RNA) molecules of the invention can be complexed or associated with a polymeric carrier.
[00475] [00475] A "polymeric vehicle" used according to the invention can be a polymeric vehicle formed by cationic components cross-linked with disulfide. The disulfide-crosslinked cationic components can be the same or different from each other. The polymeric vehicle can also contain other components.
[00476] [00476] It may be particularly preferred that the polymeric vehicle used according to the present invention comprises mixtures of cationic peptides, proteins or polymers and, optionally, additional components as defined herein, which are cross-linked by disulfide bonds as herein described. In this context, the disclosure of WO 2012/013326 is hereby incorporated by reference.
[00477] [00477] In this context, the cationic components, which form the basis of the polymeric vehicle through cross-linking with disulfide, are typically selected from any peptide, protein or (poly) cationic polymer suitable for this purpose, particularly any peptide, protein or polymer ( poly) cationic capable of complexing, and thus preferably condensing, the artificial nucleic acid molecule
[00478] [00478] Each protein, peptide or (poly) cationic polymer of disulfide crosslinking of the polymeric carrier, which can be used to complex the artificial nucleic acid (RNA) molecules, typically contains at least one component of -SH , more preferably at least one cysteine residue or any other chemical group that has a -SH component, capable of forming a disulfide bond after condensation with at least one protein, peptide or (poly) cationic polymer as a cationic component of the polymeric vehicle as mentioned here.
[00479] [00479] As defined above, the polymeric vehicle, which can be used to complex the artificial nucleic acid (RNA) molecule of the invention, can be formed by cationic (or polythionic) components cross-linked with disulfide. Preferably, those peptides, proteins or (poly) cationic polymers of the polymeric carrier, which comprise or are further modified to comprise at least one -SH component, are selected from proteins, peptides and polymers as defined herein.
[00480] [00480] In some embodiments, the polymeric carrier can be selected from a polymeric carrier molecule according to formula (IV): L-P1-S- [S-P2-S] 1-SP -L formula (IV) in which, P 'and P3 are different or identical to each other and represent a straight or branched hydrophilic polymeric chain, each P' and Pº having at least one -SH component, capable of forming a disulfide bond after condensation with the component P , or alternatively with (AA), (AA) «., or [(AA)]: if these components are used as a linker between P * and P or Pº and P ) and / or with other components (for example, (AA), (AA) x, [[AA)]: or L), the linear or branched hydrophilic polymer chain selected independently of each other from polyethylene glycol ( PEG), poly-N- (2-hydroxypropyl) methacrylamide, poly-2- (methacryloyloxy) ethyl phosphorylcholines, poly (hydroxyalkyl L-asparagine), poly (2- (methacrylyloxy) ethyl phosphorylcholine), hydroxyethyl starch or poly (hydroxyalkyl L-glutamine), wherein the hydrophilic polymer chain has a molecular weight of about 1 kDa to about 100 kDa, preferably about 2 kDa to about 25 kDa; or more preferably from about 2 kDa to about 10 kDa, for example, from about 5 kDa to about 25 kDa or 5 kDa to about 10 kDa;
[00481] [00481] In this context, the disclosure of WO 2011/026641 is incorporated here by reference. Each of the hydrophilic polymers P and Pº typically has at least one component of -SH, wherein the at least one component of -SH is capable of forming a disulfide bond after reaction with component P or with component (AA) or (AA) x, if used as a binder between P * and P or Pº and P as defined below and, optionally, with an additional component, for example L and / or (AA) or (AA)., for example, if two or more -SH components are contained. The following subformulas "P1-S-S-P " and "P 2-S-S-Pº" within the generic formula (IV) above (parentheses are omitted for better readability), where any of S, P 'and P is as defined herein, typically represents a situation, in which an SH component of the hydrophilic polymers P 'and P3 has been condensed with an -SH component of the component P of the generic formula (IV) above, wherein both sulfur of those -SH components form a disulfide bond -—S-S- as defined herein in formula (IV). These -SH components are typically supplied by each of the hydrophilic polymers P * and P3, for example, by means of an internal cysteine or any other (modified) amino acid or compound that carries a -SH component. Consequently, the sub-formulas "P! -S-S-P " and "P -S-S-P " can also
[00482] [00482] In some embodiments of the invention, the artificial nucleic acid (RNA) molecule is associated or complexed with a (poly) cationic compound or a polymeric vehicle, optionally in a weight ratio selected from a range of about from 6: 1 (w / w) to about 0.25: 1 (w / w), more preferably from about 5: 1 (w / w) to about 0.5: 1 (w / w), even more preferably about 4: 1
[00483] [00483] The artificial nucleic acid (RNA) molecule of the invention can also be associated with a vehicle, transfection agent or complexation to increase the efficiency of transfection of said artificial nucleic acid (RNA) molecule.
[00484] [00484] In this context, the artificial nucleic acid (RNA) molecule can preferably be complexed at least partially with a (poly) cationic compound and / or a polymeric carrier, preferably cationic proteins or peptides. In this context, the disclosure of WO 2010/037539 and WO 2012/113513 is hereby incorporated by reference. "Partially" means that only a part of said artificial nucleic acid (RNA) molecule is complexed with a cationic (poly) compound and / or polymeric vehicle, while the remainder of said artificial nucleic acid (RNA) molecule ) is present in the non-complex (free) form.
[00485] [00485] Preferably, the molar ratio of the complexed artificial nucleic acid (RNA) molecule to the free artificial nucleic acid (RNA) molecule can be selected from a molecular ratio.
[00486] [00486] The complexed artificial nucleic acid (RNA) molecule of the invention is preferably prepared according to a first step by complexing the artificial nucleic acid (RNA) molecule with a cationic (poly) compound and / or with a polymeric carrier - co, preferably as defined herein, in a specific relationship to form a stable complex. In this context, it is highly preferable that no (poly) cationic compound or free polymeric vehicle or just a small insignificant amount of it remains in the complexed nucleic acid (RNA) molecule fraction after complexing this artificial nucleic acid (RNA) molecule. Consequently, the relationship of the artificial nucleic acid molecule (RNA) and the cationic (poly) compound and / or the polymeric vehicle in the complexed fraction of the artificial nucleic acid (RNA) molecule is typically selected in a range so that the artificial nucleic acid (RNA) molecule is totally complexed and no compound (polycationic or free polymeric vehicle or only an insignificantly small amount remains in that fraction.
[00487] [00487] Preferably, the ratio of the artificial nucleic acid (RNA) molecule to the (poly) cationic compound and / or the polymeric carrier, preferably as defined herein, is selected from a range of about 6: 1 (w / w) to about 0.25: 1 (w / w), more preferably about 5: 1 (w / w) to about 0.5: 1 (w / w), even more preferably from about 4: 1 (w / w) to about 1: 1 (w / w) or from about 3: 1 (w / w) to about 1: 1 (w / w) and, most preferably, a ratio of about 3: 1 (w / w) to about 2: 1 (w / w).
[00488] [00488] & Alternatively, the ratio of the artificial nucleic acid (RNA) molecule to the (poly) cationic compound and / or the polymeric carrier can also be calculated based on the ratio of nitrogen / phosphate (ratio N / P) of the entire complex. In the context of the present invention, an N / P ratio is preferably in the range of about 0.1 to 10, preferably in the range of about 0.3 to 4 and most preferably in the range of about 0.5 to 2 or 0.7 to 2 in relation to the ratio of the artificial nucleic acid (RNA) molecule to the compound (polycationic and / or polymeric vehicle, preferably as defined here, in the complex and most preferable in a range of about 0.7 to 1.5, 0.5 to 1 or 0.7 to 1, and even more preferably in a range of about 0.3 to 0.9 or 0.5 to 0.9, preferably provided that the (poly) icationic compound in the complex is a cationic (poly) peptide or protein and / or the polymeric vehicle as defined above.
[00489] [00489] In other modalities, the artificial nucleic acid (RNA) molecule is supplied and used in free or naked form, without being associated with any other vehicle, transfection or complexing agent. Targeted release
[00490] [00490] In some embodiments, the artificial nucleic acid (RNA) molecules of the invention (or compositions (pharmaceuticals) or kits that comprise them) are adapted for targeted delivery to organs, tissues or cells of interest. "Targeted release" usually involves the use of targeting elements that specifically improve the translocation of the artificial nucleic acid (RNA) molecule to specific tissues or cells.
[00491] [00491] Such targeting elements (protein) can be encoded by the artificial nucleic acid (RNA) molecule, preferably in the structure with the coding sequence that encodes the desired therapeutic, antigenic, allergenic or reporter protein, so that said protein is expressed as a fusion protein comprising said protein targeting element. Alternatively, said targeting element (protein or non-protein) may be present, form part of or be associated with (poly) cationic compounds or vehicles that complex said artificial nucleic acid (RNA) molecules and / or they can be sent, form part of or be associated with lipids that involve or complex said artificial nucleic acid (RNA) molecules such as liposomes, lipid nanoparticles, lipoplexes and the like.
[00492] [00492] A "target" is a specific organ, tissue or cell for which the uptake of the artificial nucleic acid (RNA) molecule and, preferably, the expression of the encoded (poly) peptide or protein of interest is intended. "Uptake" means the translocation of the artificial nucleic acid (RNA) molecule from the extracellular to the intracellular compartment. This may involve receptor-mediated processes, fusion with cell membranes, endocytosis, potocytosis, pinocytosis or other mechanisms of translocation. The artificial nucleic acid (RNA) molecule can be absorbed alone or as part of a complex.
[00493] [00493] “As a non-limiting example, (poly) cationic compounds, vehicles, liposomes or lipid nanoparticles associated with or complexing the artificial nucleic acid (RNA) molecules of the invention can be equipped with targeting elements or functionality. menting. Additionally or alternatively, the artificial nucleic acid (RNA) molecule can encode (poly) peptides or proteins transporting, preferably through covalent bonds, targeting elements. The targeting elements can be selected
[00494] [00494] In some embodiments, the artificial nucleic acid (RNA) molecules, or compositions (pharmaceutical kits) comprising them, are adapted to target the liver. These artificial nucleic acid (RNA) molecules or compositions or kits (pharmaceuticals) may be particularly suitable for treatment, prevention, post-exposure prophylaxis or mitigation of a selected disease in the group consisting of genetic diseases , allergies, autoimmune diseases, infectious diseases, neoplasms, cancer and tumor-related diseases, inflammatory diseases, diseases of the blood and blood-forming organs, endocrine, nutritional and metabolic diseases, diseases of the nervous system, diseases diseases of the circulatory system, diseases of the respiratory system, diseases of the digestive system, diseases of the skin and subcutaneous tissue, diseases of the musculoskeletal system and connective tissue and diseases of the genital system regardless of whether they are inherited or acquired and their causes. combinations. In some modalities, artificial nucleic acid (RNA) molecules adapted for hepatic targeting comprise RTU elements according to a-2 (NDUFA4 / PSMB3);
[00495] [00495] In some embodiments, the artificial nucleic acid (RNA) molecules, or compositions (pharmaceutical kits) comprising them, are adapted for targeting the skin. In some ways, these artificial nucleic acid (RNA) molecules comprise elements of the RTU according to a-2 (NDUFA4 / PSMB3); a-5 (MP68 / PSMB3); c-1 (NDUFA4 / RPS9); a-1 (HSD17B4 / PSMB3); e-3 (MP68 / RPS9); e-4 (NOSIP / RPS9); a-4 (NOSIP / PSMB3); e-2 (RPL31 / RPS9); e-5 (ATPSA1 / RPS9); d-4 (HSD17B4 / NUDFA1); b-5 (NOSIP / COX6B1); a-3 (SLC7A3 / PSMB3); b-1 (UBQLN2 / RPS9); b-2 (ASAH1 / RPS9); b-4 (HSD17B4 / CASP1); e-6 (ATPSA1 / COX6B1); b-3 (HSD17B4 / RPS9); g-5 (RPL31 / CASP1); h-1 (RPL31 / COX6B1); and / or c-5 (ATPSA1 / PSMB3) as defined above. Such artificial nucleic acid (RNA) molecules or particles comprising such RNA molecules may, for example, comprise directing elements.
[00496] [00496] In some modalities, the artificial nucleic acid (RNA) molecules, or compositions (pharmaceutical kits) comprising them, are adapted for targeting the muscle. In some embodiments, these artificial nucleic acid (RNA) molecules comprise elements of the RTU according to a-2 (NDUFA4 / PSMB3); a-5 (MP68 / PSMB3); c-1 (NDUFA4 / RPS9); a-1 (HSD17B4 / PSMB3); e-3 (MP68 / RPS9); e-4 (NOSIP / RPS9); a-4 (NOSIP / PSMB3); e-2 (RPL31 / RPS9); e-5 (ATPSA1 / RPS9); d-4 (HSD17B4 / NUDFA1); b-5 (NOSIP / COX6B1); a-3 (SLC7A3 / PSMB3); b-1 (UBQLN2 / RPS9); b-2 (ASAH1 / RPS9); b-4 (HSD17B4 / CASP1); e-6 (ATPS5A1 / COX6B1); b-3 (HSD17B4 / RPS9); g-5 (RPL31 / CASP1); h-1 (RPL31 / COX6B1); and / or c-5 (ATPSA1 / PSMB3) as defined above. Such artificial nucleic acid (RNA) molecules or particles comprising such RNA molecules may, for example, comprise targeting elements as described below.
[00497] [00497] Targeting elements suitable for use in connection with the present invention include: lectins, glycoproteins, lipids and proteins, for example, antibodies. In particular, the targeting elements can be selected from a thyrotropin, melonotropin, lectin, glycoprotein, surfactant protein A, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine, N-acetyl-glucosamine multivalent mannose, multivalent fucose, glycosylated polyamide, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, biotin, an RGD peptide, a mimetic RGD peptide or an aptamer.
[00498] [00498] Other targeting elements can be selected from proteins, for example, glycoproteins or peptides, for example, molecules that have a specific affinity for a co-ligand, or antibodies, for example, capable of binding to a type specified cell, such as liver, tumor, muscle, skin, or kidney cell. Other targeting elements can be selected from hormones and hormone receptors. Other targeting elements can be selected from lipids, lactates, carbohydrates, vitamins, cofactors, multivalent lactose, multivalent galacto- sis, N-acetyl-galactosamine, N-acetylglucosamine multivalent mannose, multivalent fucose or aptamers. The targeting elements can bind to any suitable ligand selected from, for example, a lipopolysaccharide or a p38 MAP kinase activator.
[00499] [00499] - Other targeting elements can be selected from binders capable of targeting a specific receptor. Examples include, but are not limited to, folate, GalNAc, galactose, mannose, mannose-6P, apatamers, integrin receptor ligands, chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, (KKEEE) 3K, | LDL and HDL binders. Other targeting elements can be selected from aptamers. The aptamer may be unmodified or may have any combination of modifications disclosed herein. Composition (pharmaceutical) and vaccines
[00500] [00500] In another aspect, the present invention provides a composition comprising the artificial nucleic acid (RNA) molecule of the invention, and preferably at least one pharmaceutically acceptable carrier and / or excipient. According to preferred embodiments, the composition is provided as a pharmaceutical composition. According to other preferred embodiments, the (pharmaceutical) composition can be provided as a vaccine. A "vaccine" is typically understood as a prophylactic or therapeutic material that provides at least one antigen, preferably an antigenic peptide or protein. "Providing at least antigen" means, for example, that the vaccine comprises the antigen or that the vaccine comprises a molecule that, for example, encodes the antigen. Accordingly, it is particularly contemplated in this invention that the vaccine of the invention comprises at least one artificial nucleic acid (RNA) molecule that encodes at least one (poly) peptide or antigenic protein, as defined herein, which can, for example, be derived from a tumor antigen, a bacterial, viral, fungal or protozoan antigen, a self-antigen, an allergen or an allogeneic antigen, and preferably induces an immune response to the respective antigen when it is expressed and presented to the immune system. However, artificial nucleic acid (RNA) molecules that encode peptides (poly) peptides or non-antigenic proteins of interest can also be used in the vaccine of the invention.
[00501] [00501] The (pharmaceutical) composition or vaccine of the invention preferably comprises at least one, preferably a plurality of at least two artificial nucleic acid (RNA) molecules, as described herein. Said plurality of at least two artificial nucleic acid (RNA) molecules can be monocistronic, bistronic or multicistronic, as described herein. Each of the artificial nucleic acid (RNA) molecules in the composition (pharmaceutical) or vaccine can encode at least one or a plurality of at least two (poly) peptides or proteins (identical or different) (may be of interest. Artificial nucleic acid (RNA) molecules can be provided in the (complexed) or "free" (pharmaceutical) or vaccine composition, as described above, or a mixture thereof. The (pharmaceutical) or vaccine composition may further comprise at least one additional active agent useful for the treatment of the disease or condition that is subject to therapy with the acid molecule
[00502] [00502] Preferably, the (pharmaceutical) composition or vaccine according to the invention comprises at least one pharmaceutically acceptable carrier and / or excipient. The term "pharmaceutically acceptable" refers to a compound or agent that is compatible with one or more active agents (here: artificial nucleic acid molecule (RNA) and optionally additional active agent) and does not interfere and / or substantially reduce its pharmaceutical effect. Pharmaceutically acceptable vehicles and excipients preferably have sufficiently high purity and low enough toxicity to make them suitable for administration to an individual to be treated. Excipients
[00503] [00503] Pharmaceutically acceptable excipients can have different functional functions and include, without limitation, diluents, fillers, bulking agents, vehicles, disintegrants, binders, lubricants, glidants, coatings, solvents and co-solvents, buffering agents, preservatives , adjuvants, antioxidants, wetting agents, defoamers, thickeners, sweeteners, flavors and humectants.
[00504] [00504] “For liquid (pharmaceutical) compositions, vehicles and useful pharmaceutically acceptable excipients include solvents, diluents or vehicles such as water (pyrogen-free), saline (isotonic) solutions such as phosphate buffered saline or citrate, fixed oils, vegetable oils, such as, for example, peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, ethanol, polyols (eg, glycerol, propylene glycol, polyethylene glycol and the like); lecithin; surfactants; preservatives such as benzyl alcohol, parabens, chlorobutanol, phenol, ascorbic acid,
[00505] [00505] Ringer's solution or Ringer-Lactate solution is particularly preferred as a liquid carrier.
[00506] [00506] For (pharmaceutical) compositions in (semi) solid form, useful pharmaceutically acceptable carriers and excipients include | immigrants such as microcrystalline cellulose, tragacanth gum or gelatin; starch or lactose; sugars, such as, for example, lactose, glycoside and sucrose; starches, such as, for example, corn starch or potato starch; cellulose and its derivatives, such as, for example, sodium carboxymethyl cellulose, ethyl cellulose, cellulose acetate; disintegrants such as alginic acid; lubricants such as magnesium stearate; glidants such as stearic acid, magnesium stearate; calcium sulfate, colloidal silicon dioxide and the like; sweetening agents such as sucrose or saccharin; and / or flavoring agents, such as peppermint, methyl salicylate or orange flavoring. Formulations
[00507] [00507] Suitable pharmaceutically acceptable vehicles and excipients can typically be chosen based on the desired formulation of the composition (pharmaceutical).
[00508] [00508] “Liquid (pharmaceutical) compositions administered by injection and, in particular, by i.v. injection, must be sterile and stable under the conditions of manufacture and storage. Such compositions are typically formulated as parenterally acceptable aqueous solutions that are free of pyrogen, have adequate pH, are isotonic and maintain the stability of the active ingredients. Pharmaceutically acceptable carriers and excipients particularly useful for liquid (pharmaceutical) compositions according to the invention include water, typically pyro-free water; isotonic saline solution or buffered (aqueous) solutions, for example, phosphate buffered solutions, citrate etc. Particularly for injection of the (pharmaceutical) compositions of the invention, water or preferably a buffer, more preferably an aqueous buffer, containing a sodium salt, preferably at least 50 mM of a sodium salt, can be used. calcium salt, preferably at least 0.01 mM of a calcium salt and, optionally, a potassium salt, preferably at least 3 mM of a potassium salt.
[00509] [00509] According to the preferred modalities, the salts of sodium, calcium and, optionally, potassium can occur in the form of their halides, for example, chlorides, iodides or bromides, in the form of their hydroxides, carbonates, carbonates of hydrogen or sulfates, etc.
[00510] [00510] According to the preferred modalities, the buffer suitable for injection purposes as defined above, may contain selected salts of sodium chloride (NaCl), calcium chloride (CaCl2) and optionally potassium chloride (KCl), in which other anions may be present besides chlorides. CaCl2 can also be replaced by another salt like KCI. Typically, the salts in the injection buffer are present in a concentration of at least 50 mM sodium chloride (NaCl), at least 3 mM potassium chloride (KCl) and at least 0.01 mM chloride of calcium (CaCl2). The injection buffer can be hypertonic, isotonic or hypotonic with reference to the specific reference medium, that is, the buffer can have a higher, identical or lower salt content with reference to the specific reference medium, in which preferably these concentrations - tractions of the aforementioned salts can be used, which do not lead to cell damage due to osmosis or other concentration effects. The reference means are, for example, in "in vivo" methods that liquids such as blood, lymph, cytosolic liquids or other body fluids occur, or, for example, liquids, which can be used as a reference medium in "in vitro" methods, such as common buffers or liquids.
[00511] [00511] Such common buffers or liquids are known to a knowledgeable person. The Ringer-lactate solution is particularly preferred as a liquid base.
[00512] [00512] The (pharmaceutical) compositions for topical administration can be formulated as creams, ointments, gels, pastes or powders, using liquids or excipients or liquid and / or (semi) solid vehicles, as described herein. Compositions (pharmaceuticals) for oral administration can be formulated as tablets, capsules, liquids, powders or in a controlled release format, using liquid and / or (semi) solid liquids or excipients or vehicles as described herein.
[00513] [00513] “According to some preferred modalities, the composition (pharmaceutical) or vaccine of the invention is administered parenterally, in particular by intradermal or intramuscular injection, orally, orally, pulmonary, inhalation, topically, rectally, orally, vaginally or via an implanted reservoir, and is supplied in liquid or lyophilized formulations for parenteral administration as discussed elsewhere in this invention . Parenteral formulations are typically stored in vials, intravenous bags, ampoules, cartridges or pre-filled syringes and can be administered as injections, inhalants or aerosols, injections being preferred.
[00514] [00514] According to preferred embodiments, the inventive (pharmaceutical) compositions or vaccine may comprise artificial nucleic acid (RNA) molecules of the invention complexed with lipids, preferably in the form of lipid nanoparticles, liposomes, lipoplexes or emulsions, as described herein.
[00515] [00515] According to other preferred modalities, the composition (pharmaceutical) or vaccine is supplied in lyophilized form. Preferably, the lyophilized (pharmaceutical) composition or vaccine is reconstituted in a suitable buffer, advantageously based on an aqueous vehicle, prior to administration, for example, Ringer-Lactate solution, which is preferable, Ringer's solution, a phosphate buffer solution. In some embodiments, the inventive (pharmaceutical) or vaccine composition contains at least two, three, four, five, six or more different artificial nucleic acid (RNA) molecules, as defined herein, which can be supplied separately in the form lyophilized (optionally together with at least one additional additive) and which can be reconstituted separately in a suitable buffer (such as Ringer-Lactate solution) before use, in order to allow the individual administration of each of these artificial nucleic acid (RNA) molecules. Adjuvants
[00516] [00516] According to preferred embodiments, the composition (pharmaceutical) or vaccine of the invention may further comprise at least one adjuvant.
[00517] [00517] A "adjuvant" or "adjuvant component" in the broadest sense is typically a pharmacological and / or immunological agent that can modify, for example, enhance, the effect of other active agents, for example, therapeutic agents or vaccines. In this context, an "adjuvant" can be understood as any compound, which is suitable to support the administration and distribution of the composition of the invention (pharmaceutical). Specifically, an adjuvant can preferably enhance the immunostimulatory properties of the composition (pharmaceutical) or vaccine to which it is added. In addition, these adjuvants can, without being limited to them, initiate or increase an immune response of the innate immune system, that is, a non-specific immune response.
[00518] [00518] "Adjuvants" typically do not elicit an adaptive immune response. As far as possible, "adjuvants" do not qualify as antigens. In other words, when administered, the (pharmaceutical) composition or vaccine of the invention typically initiates an adaptive immune response due to an antigenic peptide or protein.
[00519] [00519] —Suitable adjuvants can be selected from any adjuvant known to a person skilled and suitable for the present case, that is, to support the induction of an immune response in a mammal and include, without limitation, TOM, MDP, dipepti - muramyl deo, pluronics, alum solution, aluminum hydroxide, ADJUMER'Y (polyphosphazene); aluminum phosphate gel; seaweed glucans; algamulin; aluminum hydroxide gel (alum); highly absorbent aluminum hydroxide gel of proteins; low viscosity aluminum hydroxide gel; AF or SPT (squalane emulsion (5%), Tween 80 (0.2%), Pluronic L121 (1.25%), phosphate buffered saline, pH 7.4); AVRIDINETY (propanediamine); BAY R10057Y ((N- (2-deoxy-2-L-leucylamino-bD-glucopyranosil) - N-octadecyl-dodecanoyl-amide hydroacetate); CALCITRIOL'Y (1-alpha, 25-dihydroxy-vitamin D3) ; calcium phosphate gel; CAP'Y (calcium phosphate nanoparticles); cholera holotoxin, cholera-A1-protein-AD-fragment toxin fusion protein, cholera toxin subunit B; CRL 1005 (block copolymer P1205); liposomes containing cytokine; DDA (dimethyldioctadecylammonium bromide); DHEA (dehydroepiandrosterronone); DMPC (dimiristoylphosphatidylcholine); deoxycholic); complete Freund's adjuvant; incomplete Freund's adjuvant; gamma inulin; Gerbu adjuvant (mixture of: i) N-acetylglucosaminyl- (P1-4) -N-acetylmuramil-L-alanyl-D-glutamine (GMDP) , ii) dimethyldiocta-decylammonium chloride (DDA), iii) zinc-L-proline salt complex (ZnPro-8); GM-CSF); GMDP (N-acetylglucosaminyl- (b1-4) -N-acetylmuramyl-L-alanyl-
[00520] [00520] Suitable adjuvants can also be selected from (poly) cationic compounds, as described herein, as complexing agents (see section by heading in "cationic (polyl) compounds and vehicles"), in particular peptides or proteins (polylactics, cationic (poly) polysaccharides, cationic (poly) lipids or polymeric vehicles described here. The association or complexation of the artificial nucleic acid (RNA) molecule of the composition (pharmaceutical) or vaccine with these compounds or vehicles (poly) cationic can preferably provide adjuvant properties and impart a stabilizing effect.
[00521] [00521] The ratio of the artificial nucleic acid (RNA) molecule to the (poly) cationic compound in the adjuvant component can be calculated based on the nitrogen / phosphate ratio (N / P ratio) for all complex, that is, the ratio of positively charged atoms (nitrogen) from the (poly) cationic compound to the phosphate atoms negatively charged by the artificial nucleic acid (RNA) molecule.
[00522] [00522] In what follows, when referring to "RNA", it will be understood that the respective disclosure is applicable to other artificial nucleic acid molecules, mutatis mutandis.
[00523] [00523] For example, 1 µg of RNA can contain about 3 nmol of phosphate residues, provided that said RNA has a statistical distribution of bases. In addition, 1 µg of peptide normally contains about x nmol of nitrogen residues, depending on the molecular weight and the number of basic amino acids. When calculated for (Arg) 9 (molecular weight 1424 g / mol, 9 nitrogen atoms), 1 ug (Arg) 9 contains about 700 pmol (Arg) 9 and therefore 700 x 9 = 6300 pmol of basic amino acids = 6.3 nmol of nitrogen atoms. For a mass ratio of about 1: 1 RNA / (Arg) 9, an N / P ratio of about 2 can be calculated. When exemplarily calculated for protamine (molecular weight 4250 g / mol, 21 nitrogen atoms, when salmon protamine is used) with a mass ratio of about 2: 1 with 2 µg of RNA, 6 nmol of phosphate must be calculated for RNA; 1 ug of protamine contains about 235 pmol of protamine molecules and therefore 235 x 21 = 4935 pmol of basic nitrogen atoms = 4.9 nmol of nitrogen atoms. For a mass ratio of about 2: 1 RNA / protamine, an N / P ratio of about 0.81 can be calculated. For a mass ratio of about 8: 1 RNA / protamine, an N / P ratio of about 0.2 can be calculated. In the context of the present invention
[00524] [00524] The (pharmaceutical) composition or vaccine of the present invention can be obtained in two separate steps, in order to obtain both an efficient immunostimulatory effect and an efficient translation of the artificial nucleic acid (RNA) molecule comprised by the aforementioned composition or vaccine (pharmaceutical).
[00525] [00525] In a first step, an RNA is complexed with a (poly) cationic compound in a specific relationship to form a stable complex ("complexed (RNA")). In this context, it is important that no free (poly) cationic compounds or just a small negligible amount remain in the complexed RNA fraction. Thus, the relationship between RNA and the cationic (poly) compound is typically selected in a range where the RNA is completely complexed and no free (poly) cationic compound or only a negligibly small amount remains in the composition . Preferably, the ratio of RNA to the (poly) cationic compound is selected from a range of about 6: 1 (w / w) to about 0.25: 1 (w / w), more preferably from about 5: 1 (w / w) to about 0.5: 1 (w / w), even more preferably from about 4: 1 (w / w) to about 1: 1 (w / w) p) or from about 3: 1 (w / w) to about 1: 1 (w / w), and most preferably a ratio of about 3: 1 (w / w) to about 2: 1 ( w / w).
[00526] [00526] In a second stage, an RNA is added to the complexed RNA to obtain the composition (pharmaceutical) or vaccine of the invention. In it, said added RNA is present as free RNA, preferably as free mRNA, which is not complexed by other compounds. Before the addition, the free RNA is not complexed and, preferably, will not undergo any detectable or significant complex reaction after the addition to the complexed RNA. This is due to the strong binding of the (poly) cationic compound to the complexed RNA. In other words, when the free RNA is added to the complexed RNA, preferably no free or substantially free (poly) cationic compound is present, which could form a complex with said free RNA. Consequently, the free RNA of the (pharmaceutical) composition or vaccine of the invention can be efficiently transcribed in vivo.
[00527] [00527] It may be preferable that the free RNA may be identical or different from the complexed RNA, depending on the specific requirements of the therapy. Even more preferably, the free RNA, which is comprised in the composition (pharmaceutical) or vaccine, is identical to the complex epitope encoding RNA, in other words, the combination, composition (pharmaceutical) or vaccine comprises an identical RNA in the form both free and complex.
[00528] [00528] "In particularly preferred embodiments, the composition (pharmaceutical) or vaccine of the invention thus comprises RNA as defined herein, wherein said RNA is present in said composition (pharmaceutical) or vaccine partly as free RNA and partly as complexed RNA. Preferably, the RNA as defined herein, preferably an mMRNA, is complexed as described above and the same (mM) RNA is then added in the form of free RNA, where preferably the compound that is used to complex the RNA is not present in the free form in the composition at the time of addition of the free RNA.
[00529] [00529] The relationship of complexed RNA and free RNA can be selected depending on the specific requirements of a particular therapy. Typically, the ratio of complexed RNA and free RNA is selected so that a significant stimulation of the innate immune system is caused due to the presence of complementary RNA.
[00530] [00530] - In addition or alternatively, the ratio of complexed RNA and free RNA can be calculated based on the nitrogen / phosphate ratio (N / P ratio) of the entire RNA complex. In the context of the present invention, an N / P ratio is preferably in the range of about 0.1 to 10, preferably in the range of about 0.3 to 4 and more preferably in the range of about 0.5 to 2 or 0 , 7 to 2 with respect to the RNA: peptide ratio in the complex, and most preferable in the range of about 0.7 to 1.5.
[00531] [00531] - In addition or alternatively, the ratio of complexed RNA and free RNA can also be selected based on the molar ratio of both RNAs to each other. Typically, the molar ratio of complexed RNA to free RNA can be selected so that the molar ratio is sufficient for the above definitions (w / w) and / or N / P. More preferably, the molar ratio of complexed RNA to free RNA can be selected, for example, from a molar ratio of about 0.001: 1, 0.01: 1, 0.1: 1, 0.2: 1 , 0.3: 1, 0.4: 1, 0.5: 1, 0.6: 1, 0.7: 1, 0.8: 1, 0.9: 1, 1: 1, 1: 0 , 9, 1: 0.8, 1: 0.7, 1: 0.6, 1: 0.5, 1: 0.4, 1: 0.3, 1: 0.2, 1: 0.1 , 1: 0.01, 1: 0.001, etc. or any range formed by any two of the above values, for example, a selected range of about 0.001: 1 to 1: 0.001, including a range of about
[00532] [00532] Even more preferably, the molar ratio of the complex RNA to the free RNA can be selected, for example, from a range of about 0.01: 1 to 1: 0.01. More preferably, the molar ratio of complexed RNA to free RNA can be selected, for example, from a molar ratio of about 1: 1. Any of the above definitions in relation to (w / w) and / or N / P ratio can also be applied.
[00533] [00533] According to preferred embodiments, the composition (pharmaceutical) or vaccine comprises another nucleic acid, preferably as an adjuvant.
[00534] Accordingly, the composition (pharmaceutical) or vaccine of the invention further comprises a non-coding nucleic acid, preferably RNA, selected from the group consisting of small interfering RNA (siRNA), antisense RNA (asRNA), circular RNA (cir - cCcRNA), ribozymes, aptamers, riboswitches, immunostimulatory RNA (iSRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), micro CroRNA (miRNA) and Piwi interaction RNA (piRNA).
[00535] [00535] - In the context of the present invention, non-coding nucleic acids, preferably RNAs, of particular interest include "immunostimulatory" or "is" nucleic acids, preferably RNAs. Nucleic acids or "immunostimulatory" or "is" RNAs are typically employed as adjuvants in the (pharmaceutical) composition or vaccine according to the invention.
[00536] [00536] According to a particularly preferred embodiment, the adjuvant nucleic acid comprises a nucleic acid of the following formula (VI) or (VII): GIXmGn (formula (VI)) where: G is a nucleotide comprising guanine, uracil or a analogue of guanine or uracil; X is a nucleotide comprising guanine, uracil, adenine, thymine, cytosine or its analogue; L is an integer from 1 to 40, where when | = 1 G is a nucleotide comprising guanine or its analogue; when | > 1 at least 50% of the nucleotides comprise guanine or its analogue; m is an integer and is at least 3;
[00537] [00537] The nucleic acids of formula (VI) or (VII), which can be used as isRNA can be relatively short nucleic acid molecules with a typical length of approximately 5 to 100 (but can also be greater than 100 nucleotides for specific modalities, for example, up to 200 nucleotides), from 5 to 90 or from 5 to 80 nucleotides, preferably a length of approximately 5 to 70, more preferably a length of approximately 8 to 60 and, more preferably, a length of approximately 15 to 60 nucleotides, more preferably 20 to 60, most preferably 30 to 60 nucleotides. If the epitope encoding RNA (or any other nucleic acid, in particular RNA, as disclosed herein) has a maximum length of, for example, 100 nucleotides, m will typically be <98.
[00538] [00538] The number of nucleotides "G" in the nucleic acid of formula (VI) is determined by | or no. 1 and n, independently of each other, are both an integer from 1 to 40, where when loun = 1G is a nucleotide comprising guanine or its analogue and when | or n> 1 at least 50% of the nucleotides comprise guanine or its analogue.
[00539] [00539] - For example, without implying any limitation, when | or n = 4 Gl or Gn can be, for example, a GUGU, GGUU, UGUG, UUGG, GUUG, GGGU, GGUG, GUGG, UGGG or GGGG, etc .; when | or n = 5 GI or Gn can be, for example, a GGGUU, GGUGU, GUGGU, UGGGU, UGGUG, UGUGG, UUGGG, GUGUG, GGGGU, GGGUG, GGUGG, GUGGG, UGGGG or GGGGG, etc.
[00540] [00540] A nucleotide adjacent to Xm in the formic nucleic acid
[00541] [00541] Likewise, the number of "C" nucleotides in the nucleic acid of formula (VII) is determined by | or no. l and n, independently of each other, are both an integer from 1 to 40, where when | or n = 1 C is a nucleotide comprising cytosine or its analogue and when | or n> 1 at least 50% of the nucleotides comprise cytosine or its analogue.
[00542] [00542] - For example, without implying any limitation, when | or n = 4, Cl or Cn can be, for example, a CUCU, CCUU, UCUC, UUCC, CUUC, CCCU, CCUC, CUCC, UCCOC or ACPC, etc .; when | or n = 5 Cl or Cn can be, for example, a CCCUU, CCUCU, CUC-CU, UCCCU, UCCUC, UCUCC, UVUCCOC, CUCUC, IncorporaçõesU, CCCUC, CCOUCC, CUCCC, UCCOCC or ACPC, etc.
[00543] [00543] “A nucleotide adjacent to Xm in the nucleic acid of formula (VII) preferably does not comprise uracil. Preferably, for formula (VI), when | or n> 1, at least 60%, 70%, 80%, 90% or even 100% of the nucleotides comprise guanine or its analogue, as defined above.
[00544] [00544] The remaining nucleotides to 100% (when nucleotides comprising guanine constitute less than 100% of the nucleotides) in the G1 and / or Gn flanking sequences are uridine or its analog, as defined above. Also preferably, 1 and n, independently of each other, are both an integer from 2 to 30, more preferably an integer from 2 to 20 and even more preferably an integer from 2 to 15. The lower limit of | or n can be varied if necessary and is at least 1, preferably at least 2, more preferably at least 3, 4, 5, 6,7, 8, 92 or
[00545] [00545] - According to another preferred embodiment, isRNA, as described herein, consists of or comprises a nucleic acid of formula (VII!) Or (IX): (NuGIXmGnNy) to (formula (VIII) where:
[00546] [00546] For formula (IX), any of the definitions given above for the elements N (ie Nu and Ny) and X (Xm), particularly the central structure as defined above, as well as for the integers a, |, m, n, u and v, apply in a similar way to the elements of formula (V) correspondingly, in which in formula (IX) the central structure is defined by CIXmCn. The definition of the border elements Nu and Nv is identical to the definitions given above for Nu and Nv.
[00547] [00547] In particular, in the context of formulas (VI) to (IX) above, a "nucleotide" is understood as a molecule that comprises or preferably consists of a nitrogenous base (preferably selected from adenine (A), cytosine (C) , guanine (G)), thymine (T) or uracil (U), a pentose sugar (ribose or deoxyribose) and at least one phosphate group. "Nucleosides" consist of a nucleobase and a pentose sugar (that is, they can be called "nucleotides without phosphate groups"). Thus, a "nucleotide" comprising a specific base (A, C, G, T or U) also preferably comprises the respective nucleoside (adenosine, cytidine, guanosine, thymidine or uridine, respectively) in addition to one (two, three or plus) phosphate groups.
[00548] [00548] That is, the term "nucleotides" includes nucleoside monophosphates (AMP, CMP, GMP, TMP and UMP), nucleoside diphosphates (ADP, CDP, PIB, TDP and UDP), nucleoside triphosphates (ATP, CTP, GTP, TTP and UTP). In the context of formulas (VI) to (IX) above, nucleoside monophosphates are particularly preferred. The term "a nucleotide comprising (...) or its analog" refers to modified nucleotides comprising a modified backbone (phosphate), pentose sugar or nucleobases. In this context, modifications of the nucleobases are particularly preferred. As an example, when referring to "a nucleotide comprising guinine, uracil, adenine, thymine, cytosine or its analog", the term "its analog" refers to the nucleotide and nucleobases cited, preferably to the nucleobases cited.
[00549] [00549] “In preferred embodiments, the (pharmaceutical) composition or vaccine of the invention comprises at least one immunostimulatory RNA that comprises or consists of a nucleic acid sequence according to formula (VI) (GIXmGrn), formula (VII) (CXmCn), formula (VII!) (NuGIXmGrNy) a, and / or formula (IX) (Nu.CIXmCnNy) a). In particularly preferred modes, the (pharmaceutical) composition or vaccine of the invention comprises at least one immunostimulatory RNA that comprises or consists of a nucleic acid sequence according to any SEQ ID NO, as shown in WO2008 014979, WO2009030481, WO2009095226 or WO2015149944.
[00550] [00550] In particularly preferred embodiments, the (pharmaceutical) composition or vaccine of the invention comprises a polymeric vehicle loading complex, formed by a polymeric vehicle, preferably comprising disulfide-crosslinked cationic peptides, preferably Cys-Arg12 and / or Cys-Argi2-Cys, and at least one isRNA, preferably comprising or consisting of a nucleic acid sequence according to any SEQ ID NO, as shown in WO2008014979, WO2009030481, WO2009095226 or WO2015149944.
[00551] [00551] The (pharmaceutical) composition or vaccine of the invention may additionally contain one or more auxiliary substances, in order to increase its immunogenicity or immunostimulatory capacity, if desired. A synergistic action of the loading complex of the polymeric vehicle of the invention, as defined herein, and an auxiliary substance, which may optionally be contained in the composition (pharmaceutical) or vaccine of the invention as defined herein, is preferably achieved in this way. . Depending on the various types of auxiliary substances, various mechanisms can be taken into account in this regard. For example, compounds that allow the maturation of dendritic cells (DCs), for example, lipopolysaccharides, TNF-alpha or CDA40 ligand, form a first class of suitable auxiliary substances. In general, it is possible to use as an auxiliary substance any agent that influences the immune system in the form of a "danger signal" (LPS, GP96 etc.) or cytokines, such as GM-CFS, which allows an immune response to be intensified and / or influenced in a targeted manner. Particularly preferred auxiliary substances are cytokines, such as monocines, lymphokines, interleukins or chemokines, which further promote the innate immune response, such as IL-1,
[00552] [00552] The (pharmaceutical) composition or vaccine of the invention may additionally contain any other compound, which is known to be immunostimulatory due to its binding affinity (as binders) to human Toll type receptors TLR1, TLR2, TLR3, TLRA, TLR5, TLR6, TLR7, TLR8, TLR9, TLR1O, or due to their binding affinity (as ligands) to the murine TLRI1, TLR2, TLR3, TLRA4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR1IO, TLR11 receptors , TLR12 or TLR13.
[00553] [00553] The (pharmaceutical) composition or vaccine of the invention may additionally contain CpG nucleic acids, in particular CpG-RNA or CpG-DNA. A CpG-RNA or CpG-DNA can be a single-stranded CpG-DNA (SS CpG-DNA), a double-stranded CpG-DNA (dsD-NA), a single-stranded CpG-RNA (ss CpG-RNA) or a double-stranded CpG RNA (CpG-RNA ds). The CpG nucleic acid is preferably in the form of CpG-RNA, more preferably in the form of single-stranded CPG-RNA (ss CPG-RNA). The CpG nucleic acid preferably contains at least one or more cytokine / guanine dinucleotide (mitogenic) sequences (CpG motifs). According to a preferred first alternative, at least one CpG motif contained in these sequences, i.e., C (cytosine) and G (guanine) of the CpG motif, is unmethylated. All other cytosines or guanines optionally contained in these sequences can be methylated or unmethylated. According to an additional preferred alternative, however, C (cytosine) and G (guanine) of the CpG motif may also be present in methylated form.
[00554] [00554] In a further aspect, the present invention relates to a kit or kit of parts comprising the artificial nucleic acid molecule (RNA) and / or the composition (pharmaceutical) or vaccine of the invention.
[00555] [00555] In the kit or kit of parts of the invention, at least one artificial nucleic acid (RNA) molecule in lyophilized or liquid form, optionally together with one or more pharmaceutically acceptable vehicles, excipients or other agents as described above in context of the pharmaceutical composition.
[00556] [00556] - Optionally, the kit or kit of parts of the invention can comprise at least one additional agent, as defined herein in the context of the pharmaceutical composition, antimicrobial agents, RNAse inhibitors, solubilizing agents or the like.
[00557] [00557] The kit of parts can be a Kit of two or more parts and typically comprises its components in suitable containers. For example, each container can be in the form of bottles, bottles, pressure bottles, glass bottles, sealed gloves, wraps or bags, tubes or blister packs or any other suitable form, as long as the container is configured to prevent premature mixing of components. Each of the different components can be supplied separately, or some of the different components can be supplied together (that is, in the same container).
[00558] [00558] “A container can also be a compartment or a chamber inside a bottle, a tube, a glass bottle or a wrap or a glove, or a blister or bottle, as long as the contents of one compartment are not able to physically associate with the contents of another compartment before their deliberate mixing by a pharmacist or doctor.
[00559] [00559] The kit of parts may, in addition, contain technical instructions with information on the administration and dosage of any of its components. Medical use and treatment
[00560] [00560] The artificial nucleic acid molecule (RNA) or the composition (pharmaceutical) or vaccine or kit of the invention can be used for human medical purposes and also for veterinarians, preferably for human medical purposes.
[00561] [00561] - In accordance with an additional aspect, the invention thus relates to the artificial nucleic acid molecule (RNA), composition (pharmaceutical) or vaccine or kit of the invention for use as a medicine.
[00562] [00562] The artificial nucleic acid molecule (RNA), composition (pharmaceutical) or vaccine or kit of the invention can be used for the treatment of genetic diseases, cancer, autoimmune diseases, inflammatory diseases and infectious diseases, or other diseases or conditions .
[00563] [00563] According to an additional aspect, the invention thus relates to the artificial nucleic acid molecule (RNA), composition (pharmaceutical) or vaccine or kit of the invention for use in a method of treating genetic diseases , cancer, autoimmune diseases, inflammatory diseases, and infectious diseases or other diseases or conditions.
[00564] [00564] "Gene therapy" preferably involves modulating (ie, restoring, enhancing, decreasing or inhibiting) gene expression in an individual in order to achieve a therapeutic effect. To this end, gene therapy typically encompasses the introduction of nucleic acids into cells. The term generally refers to the manipulation of a genome for therapeutic purposes and includes the use of genome editing technologies to correct mutations that cause disease, the addition of therapeutic genes to the genome, the removal of harmful genes or sequences of genome and modulation of gene expression. Gene therapy may involve in vivo or ex vivo transformation of host cells.
[00565] [00565] The term "treatment" or "treating" of a disease includes prevention or protection against the disease (that is, preventing clinical symptoms from developing); inhibition of the disease (interrupting or suppressing the development of clinical symptoms); and / or alleviate the disease (that is, cause the regression of clinical symptoms). As will be noted, it is not always possible to distinguish between "preventing" and "suppressing" a disease or disorder, since the definitive inductive event or events may be unknown or latent. Consequently, the term "prophylaxis" will be understood to constitute a type of "treatment" that encompasses both "prevention" and "suppression". The term "treatment" thus includes "prophylaxis".
[00566] [00566] The term "person", "patient" or "individual", as used in this invention, generally includes humans and non-human animals and preferably mammals (for example, non-human primates, including marmosets, monkeys , spider monkey, owl monkey, vervet monkey, squirrel monkey and baboons, monkeys, chimpanzees, orangutans, gorillas; cows; horses; sheep; pigs; chicken; cats; dogs; mice; rats; rabbits; guinea pigs ; etc.), including chimeric and transgenic animals and disease models. In the context of the present invention, the term "individual" preferably refers to a non-human primate or human being, more preferably a human being.
[00567] [00567] Accordingly, the present invention further provides methods of treating a disease as disclosed herein, upon administration to an individual with his need for a pharmaceutically effective amount of the artificial nucleic acid (RNA) molecule, composition (pharmaceutical) or vaccine or kit. Such methods may comprise an optional first stage of preparing the
[00568] [00568] The artificial nucleic acid (RNA) molecule of the invention, the composition (pharmaceutical) or vaccine or kit can be administered, for example, systemically or locally.
[00569] [00569] Routes for systemic administration in general include, for example, transdermal, oral, parenteral routes of administration, including subcutaneous, intravenous, intramuscular, intraarterial, intradermal and intraperitoneal and / or intranasal injections.
[00570] [00570] Routes for local administration in general include, for example, topical administration routes, but also intradermal, transdermal, subcutaneous or intramuscular injections or intralesional, intratumoral, intracranial, intrapulmonary, intracardial and sublingual injections.
[00571] [00571] —In the event that more than one different artificial nucleic acid (RNA) molecule must be administered, different routes of administration for each of said different artificial nucleic acid (RNA) molecules can be used.
[00572] [00572] According to the preferred modalities, the artificial nucleic acid (RNA) molecule, composition (pharmaceutical) or vaccine or kit is administered via a parenteral route, preferably by intradermal, subcutaneous or intramuscular routes. Preferably, said artificial nucleic acid (RNA) molecule, composition (pharmaceutical) or vaccine or kit can be administered by injection, for example, subcutaneous, intramuscular or intradermal injection, which can be injection without a needle and / or with a needle . Consequently, in the preferred modalities
[00573] [00573] The artificial nucleic acid molecule (RNA), composition (pharmaceutical) or vaccine or kit of the invention can be administered to an individual with his / her needs several times a day, daily, every day, weekly or monthly; and can be administered sequentially or simultaneously.
[00574] [00574] In the case where different artificial nucleic acid (RNA) molecules are administered, or the composition (pharmaceutical) or vaccine or kit comprises several components, for example, different artificial nucleic acid (RNA) molecules and , optionally, additional active agents, as described herein, each component can be administered simultaneously (at the same time through the same or different routes of administration) or separately (at different times through the same or different routes of administration). Such a sequential administration scheme is also called "time-scaled" administration. Time-phased administration may mean that an artificial nucleic acid (RNA) molecule of the invention is administered, for example, before, simultaneous or subsequent to an artificial nucleic acid (RNA) molecule other than the invention, or any other additional active agent. Dose
[00575] [00575] The artificial nucleic acid molecule (RNA), composition (pharmaceutical) or vaccine or kit of the invention can preferably be administered in a safe and therapeutically effective amount.
[00576] [00576] "As used herein," safe and (therapeutically) effective amount "means an amount of active agents that is sufficient to elicit a desired biological or medicinal response in a tissue, system, animal or human being being sought. A safe and therapeutically effective amount is preferably sufficient to induce a positive modification of the disease to be treated, that is, to relieve the symptoms of the disease to be treated, to reduce the progression of the disease or to prevent the prophylaxis of the symptoms of the disease. . At the same time, however, a "safe and therapeutically effective amount" is preferably small enough to avoid serious side effects, that is, to allow a sensible connection between advantage and risk.
[00577] [00577] A "safe and (therapeutically) effective amount" will also vary in connection with the particular condition to be treated and also with the age, physical condition, body weight, sex and diet of the patient to be treated, the severity of condition, duration of treatment, the nature of the accompanying therapy, the particular pharmaceutically acceptable vehicle or excipient used, the treatment regimen and similar factors.
[00578] [00578] A "safe and (therapeutically) effective amount" of the artificial nucleic acid (RNA) molecule can furthermore be selected depending on the type of artificial nucleic acid (RNA) molecule, for example, monocistronic RNA, bi or even multicistronic, since a bi or even multicistronic RNA can lead to significantly higher expression of the encoded (poly) peptide or protein of interest with an equal amount of a monocistronic RNA.
[00579] [00579] The therapeutic efficacy and toxicity of the artificial nucleic acid molecule (RNA) of the invention, composition (pharmaceutical) or vaccine or kit can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, for determine the LD50 (the lethal dose for 50% of the population) and the ED50 (the therapeutically effective dose in 50% of the population). Exemplary animal models suitable for determining a "safe and (therapeutically) effective amount of artificial nucleic acid (RNA) molecules, compositions (pharmaceuticals) or kits disclosed in this invention include, without limitation, rabbit, sheep, mouse, rat , dog and non-human primate models.The dose relationship between toxic and therapeutic effects is the therapeutic index and can be expressed as the LD50 / ED50 ratio. Artificial nucleic acid (RNA) molecules, compositions (pharmaceutical or kits with high therapeutic indexes are generally preferred.The data obtained from cell culture assays and animal studies can be used in the formulation of a dosage range for use in humans. compounds are preferably within a range of circulating concentrations that include ED50 with little or no toxicity.
[00580] [00580] For example, therapeutically effective doses of the artificial nucleic acid (RNA) molecule of the invention, composition (pharmaceutical) or vaccine or kit described herein can range from about 0.001 mg to 10 mg, preferably about 0, 01 mg to 5 mg, more preferably from about 0.1 mg to 2 mg per dosage unit or from about 0.01 nmol to 1 mmol per dosage unit, in particular from 1 nmol to 1 mmol per unit dosage, preferably from 1 upmol to 1 mmol per dosage unit. It is also anticipated that the therapeutically effective dose of the artificial nucleic acid molecule
[00581] [00581] In preferred embodiments, artificial nucleic acid (RNA) molecules, composition (pharmaceutical) or vaccine or kit are used for the treatment or prophylaxis of genetic diseases.
[00582] [00582] As used herein, the term "genetic disease" includes any disease, disorder or condition caused, characterized or related to abnormalities (that is, deviations from the wild, healthy and non-symptomatic state) in the genome. Such abnormalities can include a change in the number of chromosomal copies (for example, aneuploidy) or a part of them (for example, eliminations, duplications, amplifications); or a change in the chromosomal structure (for example, translocations, point mutations). The anomaly of the genomes can be hereditary (recessive or dominant) or non-hereditary. Genomic anomalies can be present in some cells of an organism or in all cells of that organism and include autosomal abnormalities, linked to X, linked to Y and mitochondrials.
[00583] [00583] In addition, the present invention allows to treat all diseases, hereditary diseases or genetic diseases as mentioned in WO 2012/013326 A1, which is incorporated herein by reference in its entirety. Cancer
[00584] [00584] In preferred embodiments, artificial nucleic acid (RNA) molecules, composition (pharmaceutical) or vaccine or kit are used for cancer treatment or prophylaxis.
[00585] [00585] - As used in this invention, the term "cancer" refers to a neoplasm characterized by the uncontrolled and generally rapid proliferation of cells that tend to invade the surrounding tissue and metastasize to distant sites of the body. The term covers benign and malignant neoplasms. Malignancy in cancers is typically characterized by anaplasia, invasiveness and metastasis; whereas benign malignancies usually have none of these properties. The terms include neoplasms characterized by the growth of tumors, as well as cancers of the blood and lymphatic system.
[00586] [00586] In some embodiments, artificial nucleic acid (RNA) molecules, composition (pharmaceutical) or vaccine or kit according to the invention can be used as a medicine, particularly for the treatment of diseases of tumors or cancer. In this context, treatment preferably involves intratumor application, especially by intratumor injection. Consequently, the artificial nucleic acid (RNA) molecules, composition (pharmaceutical) or vaccine or kit according to the invention can be used for the preparation of a medicament for the treatment of tumoral or cancerous diseases, said medicament being particularly suitable for intratumoral application (administration) for the treatment of tumor or cancerous diseases.
[00587] [00587] Preferably, tumor and cancer diseases, as mentioned herein, are selected from tumor or cancer diseases which preferably include, for example, Acute lymphoblastic leukemia, Acute myeloid leukemia, Adrenocortical carcinoma, Cancer AIDS-related, AIDS-related lymphoma, Anal cancer, Appendix cancer, Astrocytoma, Basal cell carcinoma, Bile duct cancer, Bladder cancer, Bone cancer, Osteosarcoma / Malignant fibrous histiocytoma, Brain stem glioma, Brain tumor, Astrocytoma cerebellar, cerebral astrocytoma / malignant glioma,
[00588] [00588] - In addition, the present invention allows to treat all diseases or cancerous diseases as mentioned in WO 2012/013326 A1 or WO 2017/109134 A1, which are incorporated herein by reference in their entirety. Infectious diseases
[00589] [00589] In preferred embodiments, artificial nucleic acid (RNA) molecules, composition (pharmaceutical) or vaccine or kit are used for the treatment or prophylaxis of infectious diseases.
[00590] [00590] The term "infection" or "infectious disease" refers to the invasion and multiplication of microorganisms such as bacteria, viruses and parasites that are not normally present in the body. An infection may not cause symptoms and be subclinical, or it may cause symptoms and be clinically apparent. An infection can remain localized or can spread through the blood or lymphatic system to become systemic. Infectious diseases, in this context, preferably include infectious viral, bacterial, fungal or proto-zoological diseases.
[00591] [00591] In particular, infectious diseases can be selected from Acinetobacter infections, sleeping sickness in Africa (African trypanosomiasis), AIDS (acquired immunodeficiency syndrome), amoebiasis, anasmosmosis, anthrax, appendicitis, Arcane-
[00592] [00592] “Other infectious diseases include infections caused by Acinetobacter baumannii, Anaplasma genus, Anaplasma phago-cytophilum, Ancylostoma braziliense, Ancylostoma duodenale, Arca-nobacterium haemolyticum, Ascaris lumbricoides, Aspergillusus Bacus, Genovis, Bacovia Barto- nella henselae, BK virus, Blastocystis hominis, Blastomyces dermati- tidis, Bordetella pertussis, Borrelia burgdorferi, Borrelia genus, Borrelia spp, Brucella genus, Brugia malayi, Bunyaviridae family, Burkholderia cepacia and other Burkholderia species, Burkholderia mallei, Burkholderia pseudomaliei, Caliciviridae family, Campylobacter genus, Candida da albicans, Candida spp, Chlamydia trachomatis, Chlamydophila pneumoniae, Chlamydophila psittaci, CJD prion, Clonorchis sinensis, Clostridium botulinum, Clostridium peric, Clostridium peric, Clostridium peric, Clostridium peric, Clostridium peric - des spp, coronaviruses, Corynebacte rium diphtheriae, Coxiella burnetil, Crimean-Congo hemorrhagic fever virus, Cryptococcus neo-formans, Cryptosporidium genus, Cytomegalovirus, Dengue virus (DEN-1, DEN-2, DEN-3 and DEN), Dientamoeba fragilis, Ebolavirus (EBOV), Echinococcus genus, Ehrlichia chaffeensis, Ehrlichia ewingii, Ehrlichia genus, Entamoeba histolytica, Enterococcus genus, Enterovirus genus, Enteroviruses, mainly Coxsackie A and Enterovirus viruses 71 (EV71), Epidermophytonp EBV), Esche-richia coli 0157: H7, 0111 and O104: H4, Fasciola hepatica and Fasciola gigantica, FFI prion, superfamily Filarioidea, Flavivirus, Francisella tularensis, Fusobacterium genus, Geotrichum candidum, Giardia intes- spinals, Gnatdia spinosis, Gnatdia spinosis, Gnatdia spinosis, Gnatdia spinosis, Gnatdia spinosum, Gnatdia spinosum, , Guanarito virus, Haemophilus ducreyi, Haemophilus influenzae, Helicobacter pylori, Henipavirus
[00593] [00593] In preferred embodiments, artificial nucleic acid (RNA) molecules, composition (pharmaceutical) or vaccine or kit are used for the treatment or prophylaxis of autoimmune diseases.
[00594] [00594] The term "autoimmune disease" refers to any disease, disorder or condition in an individual characterized by cell, tissue and / or organ damage caused by an individual's immune reaction to their own cells, tissues and / or organs. Normally, "autoimmune diseases" result or are aggravated by the production of antibodies that are reactive with autoantigens, that is, antigens expressed by healthy body cells.
[00595] [00595] Autoimmune diseases can be broadly divided into systemic and organ-specific or localized autoimmune disorders, depending on the main clinical and pathological characteristics of each disease. Autoimmune diseases can be divided into categories of systemic syndromes, including, but not limited to, systemic lupus erythematosus (SLE), Sjogren's syndrome, scleroderma, rheumatoid arthritis and polymyositis or local syndromes that can be endocrinological ( type 1 diabetes (type 1 diabetes mellitus), Hashimoto's thyroiditis, Addison's disease, etc.), dermatological (pemphigus vulgaris), hematological (autoimmune hemolytic anemia), neural (multiple sclerosis)
[00596] [00596] In preferred embodiments, artificial nucleic acid (RNA) molecules, composition (pharmaceutical) or vaccine or kit are used for the treatment or prophylaxis of inflammatory diseases.
[00597] [00597] The term "inflammatory disease" refers to any disease, disorder or condition in an individual characterized, caused, resulting or accompanied by inflammation, preferably chronic inflammation. Autoimmune disorders may or may not be associated with inflammation. In addition, the inflammation may or may not be caused by an autoimmune disorder. Thus, certain disorders can be characterized as autoimmune and inflammatory disorders.
[00598] [00598] Exemplary inflammatory diseases in the context of the present invention include, without limitation, rheumatoid arthritis, Crohn's disease, diabetic retinopathy, psoriasis, endometriosis, Alzheiser's disease, ankylosing spondylitis, arthritis (osteoarthritis, rheumatoid arthritis (RA) , psoriatic arthritis), asthma, atherosclerosis, colitis, dermatitis, diverticulitis, fibromyalgia, hepatitis, irritable bowel syndrome (IBS), systemic lupus erythematosus (SLE), nephritis, Parkinson's disease and ulcerative colitis. Allergies
[00599] [00599] In preferred embodiments, artificial nucleic acid (RNA) molecules, composition (pharmaceutical) or vaccine or kit are used for treatment or prophylaxis of allergies.
[00600] [00600] The term "allergy" or "allergic hypersensitivity" refers to any disease, disorder or condition caused or characterized by a hypersensitivity reaction initiated by immune mechanisms in response to a substance (allergen), usually in an individual genetically predisposed (atopy). Allergy can be mediated by antibodies or cells. In most patients, the antibody normally responsible for an allergic reaction belongs to the IgE isotype (IgE-mediated allergy, type 1 allergy). In non-IgE-mediated allergy, the antibody may belong to the IgG isotype. Allergies can be classified according to the source of the antigen that evokes the hypersensitive reaction. In the context of the present invention, allergies can be selected from (a) food allergy, (b) drug allergy, (c) household dust allergy, (d) poison allergy or insect bite and (e ) pollen allergy. Alternatively, allergies can be classified based on the main symptoms of the hypersensitive reaction. In the context of the present invention, allergies can be selected from the group of (a) asthma, (b) rhinitis, (c) conjunctivitis, (d) rhinoconjutivitis, (e) dermatitis, (f) urticaria and (g) anaphylaxis. Combination therapy
[00601] [00601] The artificial nucleic acid molecule (RNA), composition (pharmaceutical) or vaccine or kit of the invention can also be used in combination therapy. Any other therapy useful for treating or preventing the diseases and disorders defined herein can be combined with the uses and methods disclosed herein.
[00602] [00602] For example, the individual receiving the artificial nucleic acid (RNA) molecule, composition (pharmaceutical) or vaccine or kit of the invention may be a cancer patient, preferably as defined herein, or a related condition, receiving chemotherapy ( for example, first-line or second-line chemotherapy), radiation therapy, chemoradiation (combination of chemotherapy and radiation), tyrosine kinase inhibitors (eg, EGFR tyrosine kinase inhibitors), antibody therapy and / or inhibitory molecules and / or checkpoint enablers (for example, CTLA4 inhibitors), or a patient who achieved a partial response or stable disease after receiving one or more of the treatments specified above. Or, the individual receiving the artificial nucleic acid (RNA) molecule, composition (pharmaceutical) or vaccine or kit of the invention may be a patient with an infectious disease, preferably as defined herein, receiving antibiotic therapy. , antifungal or antiviral.
[00603] [00603] In another aspect, the present invention thus also relates to the use of the artificial nucleic acid molecule (RNA), composition (pharmaceutical) or vaccine or kit of parts of the invention to support another cancer therapy, a infectious disease or any other disease amenable to treatment with said artificial nucleic acid molecule, (pharmaceutical) composition or vaccine or kit.
[00604] [00604] The administration of the artificial nucleic acid molecule (RNA), composition (pharmaceutical) or vaccine or kit of parts of the invention can be performed before, simultaneously and / or subsequently to the administration of another therapeutic or subjecting the patient to another therapy that is useful for the treatment of the particular disease or condition to be treated. In vitro methods
[00605] [00605] In other respects, the present invention provides useful in vitro methods for determining and preparing suitable combinations
[00606] [00606] Thus, the present invention provides a method for increasing the expression efficiency of an artificial nucleic acid (RNA) molecule comprising at least one coding region encoding a (poly) peptide or protein, preferably as disclosed in this invention, said method comprising (a) the association of said coding region with at least one 5 'RTU element derived from a 5' RTU of a gene selected from the group consisting of HSD17B4, ASAH1, ATPS5A1, MP68, NDUFAA, NOSIP, RPL31, SLC7A3, TUBB4B and UBQLN , or a corresponding RNA sequence, its homolog, fragment or variant; (b) the association of said coding region with at least one element of the 3 'UTR derived from a 3' UTR of a gene selected from the group consisting of PSMB3, CASP1, COX6B1, GNAS, NDUFA1 and RPS9, or a corresponding RNA sequence, its homologue, fragment or variant; and (c) obtaining an artificial nucleic acid (RNA) molecule.
[00607] [00607] In a further aspect, the present invention provides a method for identifying a combination of 5 'UTR and 3' UTR capable of increasing the efficiency of expression in a desired tissue or in a cell derived from the desired tissue, comprising: a) generate a library of artificial nucleic acid molecules ("test constructs"), each comprising a "reporter ORF" that encodes a detectable reporter polynucleotide, preferably selected luciferase or eGFP, operably linked to one of the 5 'RTUs and / or one of the 3 'RTUs, as defined in claim 3; b) providing an artificial nucleic acid molecule comprising said "reporter ORF" operably linked to the 5 'and 3' reference RTUs;
[00608] [00608] Figure 1: Average expression profiles of selected (poly) peptides and proteins of interest to the RNA constructs comprising RTU combinations of the invention.
[00609] [00609] Figure 2: Average expression profiles of RNA constructs comprising combinations of RTU of the invention operably linked to coding regions encoding different (poly) peptides or proteins of interest and an A64 poly (A) sequence followed by N5 as 3 'RTU.
[00610] [00610] Figure 3: Average expression profiles of RNA constructs comprising pendulum loop of polyC and histone, as well as RTU combinations of the invention operably linked to the coding region encoding different (poly) peptides or proteins of interest in different cell lines.
[00611] [00611] Figure 4: Average expression profiles of RNA constructs comprising combinations of RTU of the invention operably linked to the coding region encoding erythropoietin (EPO) in different cell lines.
[00612] [00612] Figure 5: Average expression profiles of constructions of
[00613] [00613] Figure 6: Average expression profiles of RNA constructs comprising combinations of RTU of the invention operably linked to the coding region encoding the antigen construct of the protein of interest in different cell lines.
[00614] [00614] Figure 7: Average expression profiles of RNA constructs comprising combinations of RTU of the invention operably linked to the coding region that encodes different (polypeptides or proteins of interest in HeLa cells.
[00615] [00615] Figure 8: Average expression profiles of RNA constructs comprising combinations of RTU of the invention operably linked to the coding region that encodes different (polypeptides or proteins of interest in HepG2 cells.
[00616] [00616] Figure 9: Average expression profiles of RNA constructs comprising combinations of RTU of the invention operably linked to the coding region that encodes different (polypeptides or proteins of interest in HSKMC cells.
[00617] [00617] Figure 10: Average expression profiles of RNA constructs comprising combinations of RTU of the invention operably linked to the coding region encoding the rabies virus glycoprotein (RAVG) in different cell lines.
[00618] [00618] Figure 11: Average expression profiles of RNA constructs comprising combinations of RTU of the invention operably linked to the coding region that encodes different (polypeptides or proteins of interest in HEK293T cells. EXAMPLES
[00619] [00619] “In the following, particular examples that illustrate various modalities and aspects of the invention are presented. However, the present invention should not be limited in scope by the specific modalities described herein. The following preparations and examples are provided to allow those skilled in the art to understand and practice the present invention more clearly. The present invention, however, is not limited in scope by the exemplified modalities, which are intended as illustrations of the unique aspects of the invention, and methods that are functionally equivalent are within the scope of the invention. In fact, several modifications of the invention, in addition to those described here, will be easily evident to those skilled in the art from the previous description, attached figures and examples below. All of these modifications fall within the scope of the attached claims. Example 1: Increased RAV-G expression through the use of specific RTU combinations
[00620] [00620] The cells were seeded in 96-well plates with black rim and clear optical background (Nunc Microplate; Thermo Fisher). HeLa or HDF cells were seeded 24 hours before transfection in a compatible complete cell medium (10,000 cells in 200 μl / well). HSKkMC were seeded 48 hours before transfection in Differentiation Medium containing 2% horse serum (Gibco) to induce differentiation (48,000 cells in 200 ul / well). The cells were maintained at 37ºC, 5% CO ».
[00621] [00621] On the day of transfection, the complete medium in HeLa or HDF was replaced with serum-free Opti-MEM (Thermo Fisher). The medium at HSKMC was switched through new complete differentiation.
[00622] [00622] Each RNA was complexed with Lipofectamine2000 in a ratio of 1 / 1.5 (w / v) (HeLa & HDF) or Lipofectamine3000 in a ratio of 1 / 2.5 (w / v) (HSKkMC) for 20 minutes in Opti-MEM.
[00623] [00623] The lipocomplexed mRNAs were then added to the cells for transfection with 100 ng of RNA (HeLa & HDF) or 70 ng of RNA (HSKMC) per well in a total volume of 200 µl.
[00624] [00624] - 90 minutes after the start of the transfection, 150 µl / well of transfection solution in HeLa or HDF was exchanged for 150 upl / well of complete medium. The cells were further maintained at 37 ° C, 5% CO, »before running In-cell-Western.
[00625] [00625] 24.48 or 72 hours after the start of transfection, the expression of RAV-G was quantified by In-Cell-Western using a primary antibody directed against an E marker (rabbit polyclonal IgG; Bethyl), followed by a secondary antibody coupled to IRDye (goat anti-rabbit IgG IRDye 800CW; LI-COR). All In-Cell-Western steps were performed at room temperature.
[00626] [00626] First, the cells were washed once with PBS and fixed with 3.7% formaldehyde in PBS for 20 minutes. After washing once in PBS, the cells were permeabilized with 0.1% Triton X-100 in PBS for 10 minutes. After washing 3 times with 0.1% Tween 20 in PBS, the cells were blocked for 30 minutes with Odyssey blocking buffer (PBS) (LI-COR).
[00627] [00627] The cells were then incubated for 90 minutes with primary antibody (diluted 1: 1000 in Odyssey blocking buffer (PBS)). The cells were then washed 3 times (Tween / PBS).
[00628] [00628] —Subsequently, the cells were incubated with a mixture of secondary antibody and Cell-Tag 700 Stain (LI-COR) (diluted 1: 200 and 1: 1000, respectively, in Odyssey blocking buffer (PBS)) for one hour in the dark.
[00629] [00629] After washing 4 times (Tween / PBS), PBS was added to the cells and the scanned plates using an Odyssey & CLx (LI-COR) image formation system.
[00630] [00630] Fluorescence (800 nm) was quantified using Image Studio Lite Software and the results compared with the expression of a reference construction containing the RPL32 / ALB7-UTR combination defined as 100%. The 5-UTR sequences derived from RPL32 are shown in SEQ ID NO: 21 (DNA) and 22 (RNA). The sequences of ALB7-derived 3'-RTUs are shown in SEQ ID NO: 35 (DNA) and 36 (RNA).
[00631] [00631] The medium expression profiles of the RNA constructs comprising combinations of RTU of the invention operably linked to the coding region encoding the rabies virus glycoprotein (RAVG) in different cell lines are shown in Figure 10.
[00632] [00632] “Of course, it was possible to significantly increase expression using the RTU combinations of the invention operably linked to the coding region.
[00633] [00633] More detailed results on the use of different 3 'mRNA sequences, that is, AG4NS5 (i.e., a 64A poly (A) sequence followed by N5) and C30-HSL as a 3' sequence ( that is, a poly (C) sequence having 30C followed by a pendulum loop of histone; histone SL or HSL as described above) are shown in Table 4A- | lower. The left side of Table 4A- | shows results for A64N5, the right side shows results for C30-HSL. Figure 10, as described above, is the average value of the two experiences. As in all examples, the combination of RTU RPL32 / ALB7.1 has been normalized to 100%. Table 4A-l: detailed results for RAV-G that loads the 3 'end sequences of AG4N5 or C30-HSL
[00634] [00634] The sequences that were used in this example are shown in Table 4A-II.
[00635] [00635] The cells were seeded in 96-well plates. HDF and HepG2 (10,000 cells in 200 μl / well) were seeded 24 hours before transfection in a complete compatible cell medium. HSKkMC (48,000 cells in 200 μl / well) were seeded 48 hours before transfection in Differentiation Medium containing 2% horse serum (Gibco) to induce differentiation. The cells were maintained at 37ºC, 5% CO ».
[00636] [00636] On the day of transfection, the complete medium (HDF and HepG2) was replaced with serum-free Opti-MEM (Thermo Fisher). The HSKMC medium was exchanged by means of new complete differentiation.
[00637] [00637] “Each RNA was complexed with Lipofectamine2000 in a ratio of 1 / 1.5 (w / v) (HDF and HepG2) or Lipofectamine3000 in a ratio of 1 / 2.5 (w / v) (HSKkMC) for 20 minutes on Opti-MEM.
[00638] [00638] The lipocomplexed mRNAs were then added to the cells for transfection with 100 ng per well in a total volume of 200 µl.
[00639] [00639] - 90 minutes after the start of the transfection, 150 µl / well of transfection solution in HDF and HepG2 were exchanged for 150 upl / well of complete medium. The cells were further maintained at 37 ° C, 5% CO, »before running In-cell-Western. HsEPO:
[00640] [00640] 24 hours after the start of transfection, HsEpo expression was measured in cell supernatants using a commercially available ELISA kit (RNDsystems, Cat. DEPO0O) and a Hidex Chameleon plate reader. PPluc:
[00641] [00641] 24 hours after the start of transfection, Ppluc expression was measured in cell lysates. The cells were subjected to lysis by adding 100 µl of 1x passive lysis buffer (Promega, Cat. E1941) for at least 15 minutes. The lysed cells were incubated at -80 ° C for at least 1 hour. The cells subjected to lysis were thawed and 20 µL were added to the white LIA assay plates (Greiner Cat. 655075). The plates were inserted into a Hidex Chameleon plate reader with an injection device for substrate containing beetle juice for firefly luciferase. Per well, 100 µl of beetle juice was added. Ppluc luminescence was measured by the Hidex Chameleon plate reader.
[00642] [00642] The results were compared with the expression of a reference construction containing the combination RPL32 / ALB7-UTR defined as 100%. The sequences of 5'-UTRs derived from RPL32 are shown in SEQ ID NO: 21 (DNA) and 22 (RNA). The sequences of ALB7-derived 3-UTRs are shown in SEQ ID NO: 35 (DNA) and 36 (RNA).
[00643] [00643] The average expression profiles of RNA constructs comprising combinations of RTU of the invention operably linked to the coding region encoding EPO in different cell lines are shown in Figure 4.
[00644] [00644] “Of course, it was possible to significantly increase expression by using the RTU combinations of the invention operably linked to the coding region.
[00645] [00645] “More detailed results for EPO with respect to the use of different 3 'mMRNA sequences, that is, AG4NS5 (ie, a 64A poly (A) sequence followed by N5) and C30-HSL as a se - 3 'sequence (i.e., a poly (C) sequence having 30C followed by a Histone pendulum loop; histone SL or HSL as described above) are shown in Table 4B- | below. The left side of Table 4B- | shows results for A64N5, the right side shows results for
[00646] [00646] The sequences that were used in this example are shown in Table 4B-II.
[00647] [00647] HeLa, HDF and HSKM cells were analyzed using western blotting in the cell:
[00648] [00648] The cells were seeded in 96-well plates with black rim and clear optical background (Nunc Microplate; Thermo Fisher). HeLa or HDF cells (10,000 cells in 200 μl / well) were seeded 24 hours before transfection in a compatible complete cell medium. HSKkMC (48,000 cells in 200 μl / well) were seeded 48 hours before transfection in Differentiation Medium containing 2% horse serum (Gibco) to induce differentiation. The cells were maintained at 37ºC, 5% CO ».
[00649] [00649] “On the day of transfection, the complete medium in HeLa or HDF was replaced with serum-free Opti-MEM (Thermo Fisher). The HSkMC medium was exchanged through new complete differentiation.
[00650] [00650] Each RNA was complexed with Lipofectamine2000 in the ratio of 1 / 1.5 (w / v) (HeLa & HDF) or Lipofectamine3000 in the ratio of 1 / 2.5 (w / v) (HSKMC) for 20 minutes in Opti-MEM.
[00651] [00651] The lipocomplexed mRNAs were then added to the cells for transfection with 200 ng of RNA (HeLa & HDF) or 100 ng of RNA (HSKMC) per well in a total volume of 150 µl.
[00652] [00652] - 90 minutes after the start of the transfection, 100 µl / well of transfection solution in HeLa or HDF was exchanged for 100 upl / well of complete medium. The cells were further maintained at 37 ° C, 5% CO, »before running In-cell-Western.
[00653] [00653] 36 hours after the start of transfection, the expression of POI was quantified by In-Cell-Western using a primary antibody directed against POI (mouse monoclonal antiPOl; Santa Cruz), followed by a secondary antibody coupled to IRDye (IgG goat anti-rabbit IRDye 800CW; LI-COR). All stages of the
[00654] [00654] First, the cells were washed once with PBS and fixed with 3.7% formaldehyde in PBS for 10 minutes. After washing once in PBS, the cells were permeabilized with Perm / Wash (BD) buffer for 30 minutes. The cells were blocked for 30 minutes with a mixture of Odyssey blocking buffer (PBS) (LI-COR) and Perm / Wash buffer (BD) (1: 1).
[00655] [00655] “Then, the cells were incubated for 150 minutes with primary antibody (diluted 1: 200 in Perm / Wash buffer (BD)). The cells were then washed 3 times (Perm / Wash buffer (BD)).
[00656] [00656] —Subsequently, the cells were incubated with a mixture of secondary antibody and Cell-Tag 700 Stain (LI-COR) (diluted 1: 200 and 1: 1000, respectively, in Perm / Wash (BD) buffer) during an hour in the dark.
[00657] [00657] - After washing 4 times (Perm / Wash buffer (BD)), PBS was added to the cells and the scanned plates using an Odyssey CLx (LI-COR) image formation system.
[00658] [00658] Fluorescence (800 nm) was quantified using Image Studio Lite Software and the results compared with the expression of a reference construction containing the RTU combination RPL32 / ALB7 defined as 100%. The 5-UTR sequences derived from RPL32 are shown in SEQ ID NO: 21 (DNA) and 22 (RNA). The sequences of ALB7-derived 3'-RTUs are shown in SEQ ID NO: 35 (DNA) and 36 (RNA).
[00659] [00659] Sol8 cells were analyzed using routine FACS analysis.
[00660] [00660] The cells were seeded in standard 24-well TC Plate plates F (Sarstedt). Sol8 cells (40,000 cells in 1000 μl / well) were seeded 24 hours before transfection in a compatible complete cell medium. The cells were maintained at 37 ° C, 5% CO, ».
[00661] [00661] On the day of transfection, the complete medium was replaced with serum-free Opti-MEM medium (Thermo Fisher).
[00662] [00662] Each RNA was complexed with Lipofectamine2000 in the proportion of 1 / 1.5 (w / v) for 20 minutes in Opti-MEM.
[00663] [00663] The lipocomplexed mRNAs were then added to the cells for transfection with 500 ng of RNA (per well in a total volume of 1500 µl).
[00664] [00664] 190 minutes after the start of transfection; the total transfection solution (1500 µl) in Sol8 cells was replaced by 2000 µl / well of complete medium. The cells were further maintained at 37 ° C, 5% CO, »before performing FACS analysis.
[00665] [00665] 36 hours after the start of transfection, the expression of pri was quantified by FACS analysis using a primary antibody directed against POI (anti-mouse monoclonal POl; Santa Cruz), followed by a secondary antibody coupled to APC ( Goat anti-mouse IgG APC; Biolegend). All steps of the FACS analysis were performed at room temperature or at 4ºC.
[00666] [00666] First, the cells were separated (Tris HCI 40 MM, pH 7.5 150 mM NaCl, EDTA 1 mM in H2O; 5 min at room temperature), washed once with PBS. After washing in PBS, intracellular staining was performed using antibodies directed against POI. Therefore, the cells were first incubated with Cytofix / Cytoperm (BD) for 30 minutes at 4 ° C. Then, the cells were washed in Perm / Wash buffer (0.5% BSA and 0.1% saponin in PBS) for 3 minutes. Then, the cells were incubated with primary antibody (diluted 1: 200 in Perm / Wash buffer) for 30 min at 4ºC.
[00667] [00667] After washing the cells in Perm / Wash (BD) buffer, the cells were incubated with the secondary antibody (diluted 1: 500 in Perm / Wash buffer) for 30 minutes at 4 ° C.
[00668] [00668] The cells were then washed (Perm / Wash buffer (BD)), resuspended in 100 µl of PFEA buffer (PBS + 2% FCS + 2 mM EDTA + 0.01% NaN3) and analyzed using by BD FACS Canto | l.
[00669] [00669] Live / Dead staining was performed with reactive fluorescent dye Aqua (Invitrogen).
[00670] [00670] The average fluorescence intensity was measured and the results compared with the expression of a reference construction containing the combination of RTU RPL32 / ALB7-UTR adjusted to 100%. The sequences of 5'-UTRs derived from RPL32 are shown in SEQ ID NO: 21 (DNA) and 22 (RNA). The sequences of 3-UTRs derived from ALB7 are shown in SEQ ID NO: 35 (DNA) and 36 (RNA).
[00671] [00671] As evident, it was possible to significantly increase expression through the use of the RTU combinations of the invention operably linked to the coding region. Example 4: Increased single-chain antibody expression expression of interest using specific RTU combinations
[00672] [00672] The cells were seeded in 96-well plates with black rim and light optical background (Nunc Microplate; Thermo Fisher). HeLa cells (10,000 cells in 200 μl / well) were seeded 24 hours before transfection in a compatible complete cell medium. The cells were maintained at 37ºC, 5% CO;,.
[00673] [00673] On the day of transfection, the complete medium in HeLa or HDF was replaced with serum-free Opti-MEM (Thermo Fisher). The HSkMC medium was exchanged through new complete differentiation.
[00674] [00674] 1 / 4ug MRNA single chain antibody construction of interest [c = 0.1 g / I] was complexed with Lipofectamine2000. Part of the transfection complexes was then diluted 5 times and part was diluted 10 times (medium dose). 500 ng of single-chain antibody construction of interest was then transfected into the cells. 24 hours after transfection, the cells were inspected using a microscope. The supernatant was taken and quantified in an Antibody-ELISA / anti-Fc-ELISA assay using the Goat Anti-Human IgG coating antibody (SouthernBiotech) and the Goat Anti-Human IgG Biotin detection antibody (Dianova).
[00675] [00675] “Of course, it was possible to significantly increase expression using the RTU combinations of the invention operably linked to the coding region.
[00676] [00676] An overview of the sequences that were used in this example is shown in Table 4D below, where the sequence of the undisclosed antibody construct of interest in Example 4 consists of 496 amino acids and the CDS consists of 1491 nucleic acids, whereas the antigen construct of interest of Example 5 (Table 4D) consists of 553 amino acids and the CDS consists of 1662 nucleic acids. A person skilled in the art is able to derive a corresponding sequence from the disclosure in Table 4D for Example 4. Example 5: Increased antigen construction of expression of interest using specific RTU combinations
[00677] [00677] HEK293T cells were analyzed by FACS. The 293T cells were seeded at a density of 200,000 cells / well (200,000 cells / 2 ml) in a 6-well plate. Each RNA was complexed with Lipofectamine2000 at a ratio of 1 / 1.5 (w / v) for 20 minutes in Opti-MEM. The lipocomplexed mRNAs were then added to the cells for transfection with 2 µg of RNA per well in a total volume of 500 µl. 4 h after the start of transfection, the transfection solution was exchanged for 2000 µl / well of complete medium. The cells were further maintained at 37ºC, 5% CO, before performing the FACS analysis. The strings that were used in this example are shown in Table 4D.
[00678] [00678] 24 hours after transfection, the expression of the antigen of interest was quantified by FACS analysis using standard procedures. Briefly, the cells were separated (40 mM Tris HCI, pH 7.5 150 mM NaCl, 1 mM EDTA in H20; 5 min in RT), washed with PBS and stained on the surface with a mouse antibody against the antigen. The cells were resuspended in 100 µl of PFEA buffer (PBS + 2% FCS + 2 mM EDTA + 0.01% NaN3) and analyzed using a BD FACS Canto Il. Live / Dead staining was performed with fluorescent reactive Aqua dye (Invitrogen).
[00679] [00679] The results of RNA protein expression comprising the RTU combinations of the invention operably linked to the coding sequences encoding various proteins of interest are shown in Fig. 1-11.
[00680] [00680] “As was evident, it was possible to increase significantly and synergistically the expression through the use of the RTU combinations of the invention operably linked to the coding region. Example 6: Test for synergy of RTU combinations by luciferase expression after MRNA transfection
[00681] [00681] Human dermal fibroblasts (HDF) were seeded 24 hours before transfection in a complete compatible cell medium in 96-well plates (10,000 cells in 200 µl / well). On the day of transfection, the complete medium was replaced with a serum-free OPpti-MEM medium (Thermo Fisher).
[00682] [00682] Each RNA was complexed with Lipofectamine2000 in the proportion of 1 / 1.5 (w / v). The lipocomplexed mRNAs were then added to the cells for transfection with 25 ng per well in a total volume of 200 µl. 90 minutes after the start of transfection, 150 µl / well of HDF transfection solution was exchanged for 150 µl / well of complete medium. The cells were further maintained at 37ºC, 5% CO ». The sequences that were used in this example correspond to the sequences shown in example 2, with or without 5 'RTU or respectively 3' RTU or with 5 'and 3' RTU's.
[00683] [00683] In a first set of experiments, Ppluc expression was measured in cell lysates 6 hours after the start of transfection. Other sets of experiments were followed after 24.48 or 72 hours after the start of transfection.
[00684] [00684] The cells were subjected to lysis by adding 100 μl of 1x passive lysis buffer (Promega, Cat. E1941) for at least 15 minutes. The lysed cells were incubated at -80 ° C for at least 1 hour. The lysed cells were thawed and 20 µL were added to the white LIA assay plates (Greiner Cat. 655075).
[00685] [00685] Luciferase activity was measured as relative light units (RLU) in a plate reader (Berthold Technologies Tri-tar2 LB 942).
[00686] [00686] The plates were introduced in the plate reader with injection device for beetle juice (PJK GmbH) containing substrate for firefly luciferase. Per well, 50 ul of calf juice was added.
[00687] [00687] At various times, the effect of the various combinations of RTU was then determined: * the increase in expression by the 5-RTU; * increased expression by 3-RTU; * increased expression by combining 5-UTR and 3 ”- UTR in an mRNA molecule.
[00688] [00688] “Soon after, the real increase by combinations of 5-RTU and 3'-RTU was divided by the expected increase if 5 'and 3-RTU were acting in an additive way to calculate the level of synergy. Values of> 1 indicate synergy, that is, more than an additive effect.
[00689] [00689] The results of these experiments are shown in tables 4, 5, 6 and 7, that is, Ppluc expression after 6, 24, 48 or 72 hours from the start of transfection. Table 4: Ppluc expression in cell lysates after 6 hours after the start of transfection. The plus and minus signs in columns 2a 5 show the result in the presence or absence of the respective 5'- RTU or 3-RTU - / - +/- - / + + / + Table 5: Ppluc expression in cell lysates after 24 hours after the start of transfection. The plus and minus signs in columns 2 to 5 show the result in the presence or absence of the respective
[00690] [00690] As evident, it was clearly possible to prove the synergistic effects of the RTU combinations by the expression of luciferase.

权利要求:
Claims (54)
[1]
1. Artificial nucleic acid molecule, characterized by the fact that it comprises a. at least one element of the 5 '(5' RTU) untranslated region derived from a 5 'RTU of a gene selected from the group consisting of HSD17B4, ASAH1, ATPSA1, MP68, NDUFA4, NOSIP, RPL31, SLC7A3, TUBB4B and UBQLN two; B. at least one element of the 3 '(3' RTU) untranslated region derived from a 3 'RTU of a gene selected from the group consisting of PSMB3, CASP1, COX6B1, GNAS, NDUFA1 and RPS9; and optionally c. at least one coding region operably linked to said 5 'UTR and said 3' UTR.
[2]
2. Artificial nucleic acid molecule according to claim 1, characterized by the fact that said 5 'UTR and / or said 3' UTR is heterologous to said coding region.
[3]
3. Artificial nucleic acid molecule according to claim 1 or 2, characterized by the fact that each of said RTUs comprises the naturally occurring DNA sequence and its homologues, variants, fragments and RNA sequences corresponding.
[4]
4. Artificial nucleic acid molecule according to any one of claims 1 to 3, characterized in that it comprises a-1. at least one element of the 5 'UTR derived from an S'UTR of an HSD17B4 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR a PSMB3 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or a-2. at least one element of the 5 'UTR derived from an S'UTR of an NDUFAA gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR a PSMB3 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or a-3. at least one element of the 5 'UTR derived from an S'UTR of an SLC7A3 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'UTR of a PSMB3 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or a-4. at least one element of the 5 'UTR derived from a S'UTR of a NOSIP gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'UTR of a PSMB3 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or a-5. at least one element of the 5 'UTR derived from an S'UTR of an MP68 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'UTR of a PSMB3 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or b-1. at least one element of the 5 'UTR derived from an S'UTR of a UBQLN 2 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'RTU of a RPS9 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or b-2. at least one element of the 5 'UTR derived from an S'UTR of an ASAH1 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'RTU of a RPS9 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or b-3. at least one element of the 5 'UTR derived from an S'UTR of an HSD17B4 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR a RPS9 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or b-4. at least one element of the 5 'UTR derived from an S'UTR of an HSD17B4 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR a CASP1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or b-5. at least one element of the 5 'UTR derived from a S'UTR of a NOSIP gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'UTR of a COX6B1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or c-1. at least one element of the 5 'UTR derived from an S'UTR of an NDUFAA gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR a RPS9 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or c-2. at least one element of the 5 'UTR derived from a S'UTR of a NOSIP gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'RTU of an NDUFA1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or c-3. at least one element of the 5 'UTR derived from an S'UTR of an NDUFAA gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR a COX6B1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or c-4. at least one element of the 5 'UTR derived from an S'UTR of an NDUFAA gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR an NDUFA1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or c-5. at least one element of the 5 'UTR derived from an S'UTR of an ATP5A1 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'UTR of a PSMB3 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or d-1. at least one element of the 5 'UTR derived from an S'UTR of an RPL31 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'UTR of a PSMB3 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or d-2. at least one element of the 5 'UTR derived from an S'UTR of an ATP5A1 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'UTR of a CASP1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or d-3. at least one element of the 5 'UTR derived from an S'UTR of an SLC7A3 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'RTU of a GNAS1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or d-4. at least one element of the 5 'UTR derived from an S'UTR of an HSD17B4 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR an NDUFA1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or d-5. at least one element of the 5 'UTR derived from an S'UTR of an SLC7A3 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'RTU of an NDUFA1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or e-1. at least one element of the 5 'UTR derived from an S'UTR of a TUBBA4B gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR a RPS9 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or e-2. at least one element of the 5 'UTR derived from an S'UTR of an RPL31 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'RTU of a RPS9 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or e-3. at least one element of the 5 'UTR derived from an S'UTR of an MP68 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'RTU of a RPS9 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or e-4. at least one element of the 5 'UTR derived from a S'UTR of a NOSIP gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'RTU of a RPS9 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or e-5. at least one element of the 5 'UTR derived from an S'UTR of an ATP5A1 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'RTU of a RPS9 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or e-6. at least one element of the 5 'UTR derived from an S'UTR of an ATP5A1 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'UTR of a COX6B1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or f-1. at least one element of the 5 'UTR derived from an S'UTR of an ATP5A1 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'RTU of a GNAS gene, or a corresponding RNA sequence, its homolog, fragment or variant; or f-2. at least one element of the 5 'UTR derived from an S'UTR of an ATP5A1 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'RTU of an NDUFA1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or f.3. at least one element of the 5 'UTR derived from an S'UTR of an HSD17B4 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR a COX6B1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or f-4. at least one element of the 5 'UTR derived from an S'UTR of an HSD17B4 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR a GNAS1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or f-5. at least one element of the 5 'UTR derived from an S'UTR of an MP68 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'UTR of a COX6B1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or g-1. at least one element of the 5 'UTR derived from an S'UTR of an MP68 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3 'RTU of an NDUFA1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or g-2. at least one element of the 5 'UTR derived from an S'UTR of an NDUFAA gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR a CASP1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or g-3. at least one element of the 5 'UTR derived from an S'UTR of an NDUFAA gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR a GNAS gene, or a corresponding RNA sequence, its homolog, fragment or variant; or g-4 at least one element of the 5 'UTR derived from a S'UTR of a NOSIP gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR of a CASP1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or g-5 at least one element of the 5 'UTR derived from an S'UTR of a RPL31 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR of a CASP1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or h-1 at least one element of the 5 'UTR derived from an S'UTR of an RPL31 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR of a COX6B1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or h-2 at least one element of the 5 'UTR derived from an S'UTR of an RPL31 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR of a GNAS gene, or a corresponding RNA sequence, its homolog, fragment or variant; or h-3 at least one element of the 5 'UTR derived from an S'UTR of a RPL31 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR of an NDUFA1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or h-4º at least one element of the 5 'UTR derived from an S'UTR of an SLC7A3 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR of a CASP1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or h-5 at least one element of the 5 'UTR derived from an S'UTR of an SLC7A3 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR of a COX6B1 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or i-1 / at least one element of the 5 'UTR derived from an S'UTR of an SLC7A3 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' RTU derived from a 3'UTR of an RPS9 gene, or a corresponding RNA sequence, its homolog, fragment or variant; or i-2 at least one element of the 5 'UTR derived from an S'UTR of an Ndufa4.1 gene, or a corresponding RNA sequence, its homolog, fragment or variant and at least one element of the 3' UTR derived from a 3'UTR of a CASP1 gene, or a corresponding RNA sequence, its homolog, fragment or variant.
[5]
5. Artificial nucleic acid molecule according to claim 4, characterized by the fact that it comprises elements of the RTU according to a-1, a-2, a-3, a-4 or a-5, preferably according to a-1.
[6]
6. Artificial nucleic acid molecule according to claim 4, characterized by the fact that it comprises elements of the RTU according to a-2 (NDUFA4 / PSMB3); a-5 (MP68 / PSMB3); c-1 (NDUFA4 / RPS9); a-1 (HSD17B4 / PSMB3); e-3 (MP68 / RPS9); e-4 (NOSIP / RPS9); a-4 (NOSIP / PSMB3); e-2 (RPL31 / RPS9); e-5 (ATP5A1 / RPS9); d-4 (HSD17B4 / NUDFA1); b-5 (NOSIP / COX6B1); a-3 (SLC7A3 / PSMB3); b-1 (UBQLN2 / RPS9); b-2 (ASAH1 / RPS9); b-4 (HSD17B4 / CASP1); e-6 (ATPSA1 / COX6B1); b-3 (HSD17B4 / RPS9); g-5 (RPL31 / CASP1); h-1 (RPL31 / COX6B1); and / or c-5 (ATP5A1 / PSMB3).
[7]
7. Artificial nucleic acid molecule according to claim 4, characterized by the fact that it comprises elements of the RTU according to a-1 (HSD17B4 / PSMB3); a-3 (SLC7A3 / PSMB3); e-2 (RPL31 / RPS9); a-5 (MP68 / PSMB3); d-1 (RPL31 /
PSMB3); a-2 (NDUFA4 / PSMB3); h-1 (RPL31 / COX6B1); b-1 (UBQLN2 / RPS9); a-4 (NOSIP / PSMB3); c-5 (ATP5A1 / PSMB3); b-5 (NOSIP / COX6B1); d-4 (HSD17B4 / NDUFA1); i-1 (SLC7A3 / RPS9); i-2 (Ndufa4.1 / CASP1); f-3 (HSD17B4 / COX6B1); b-4 (HSD17B4 / CASP1); g-5 (RPL31 / CASP1); c-2 (NOSIP / NDUFA1); e-4 (NOSIP / RPS9); c-4 (NDUFA4 / NDUFA1); and / or d-5 (SLC7A3 / NDUFAI).
[8]
8. Artificial nucleic acid molecule according to claim 4, characterized by the fact that it comprises elements of the RTU according to a-4 (NOSIP / PSMB3); a-1 (HSD17B4 / PSMB3); a-5 (MP68 / PSMB3); d-3 (SLC7A3 / GNAS); a-2 (NDUFAA4 / PSMB3); a-3 (SLC7A3 / PSMB3); d-5 (SLC7A3 / NDUFAI); i-1 (SLC7A3 / RPS9); d-1 (RPL31 / PSMB3); d-4 (HSD17B4 / NDUFAI1); b-3 (HSD17B4 / RPS9); f-3 (HSD17B4 / COX6B1); f-4 (HSD1I7BA4 / GNAS); h-5 (SLC7A3 / COX6B1); g-4 (NOSIP / CASP1); c-3 (NDUFA4 / COX6B1); b-1 (UBQLN2 / RPS9); c-5 (ATPSA1 / PSMB3); h-4 (SLC7A3 / CASP1); h-2 (RPL31 / GNAS); e-1 (TUBB4B / RPS9); f-2 (ATP5A1 / NDUFA1); c-2 (NOSIP / NDUFA1); b-5 (NOSIP / COX6B1); and / or e-4 (NOSIP / RPS9.1).
[9]
9. Artificial nucleic acid molecule according to any one of claims 1 to 8, characterized in that said element of the SUTR derived from an HSD17B4 gene comprises or consists of a DNA sequence according to SEQ ID NO : 1 or a DNA sequence having, in ascending order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity with the nucleic acid sequence according to SEQ ID NO: 1, or a fragment or variant thereof; or an RNA sequence according to SEQ ID NO: 2, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96% , 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 2, or a fragment or variant thereof;
-this SUTR element derived from an ASAH1 gene comprises or consists of a DNA sequence according to SEQ ID NO: 3 or a DNA sequence having, in ascending order of preference, at least 50%, 60%, 70% , 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 3, or a fragment or variant thereof; or an RNA sequence according to SEQ ID NO: 4, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 4, or a fragment or a variant thereof;
- said element of the SUTR derived from an ATP5A1 gene comprises or consists of a DNA sequence according to SEQ ID NO: 5, or a DNA sequence having, in ascending order of preference, at least 50%, 60%, 70 %, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 5, or a fragment or variant thereof; or an RNA sequence according to SEQ ID NO: 6, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 6, or a fragment or variant thereof;
-this element of the 5 RTU derived from an MP68 gene comprises or consists of a DNA sequence according to SEQ ID NO: 7, or a DNA sequence having, in increasing order of preference, at least 50%, 60 %, 70%, 80%, 90%, 95%, 96%,
97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 7, or a fragment or variant thereof; or an RNA sequence according to SEQ ID NO: 8, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 8, or a fragment or variant thereof;
- said element of the SUTR derived from an NDUFA4 gene comprises or consists of a DNA sequence according to SEQ ID NO: 9, or a DNA sequence having, in ascending order of preference, at least 50%, 60%, 70 %, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 9, or a fragment or variant thereof; or an RNA sequence according to SEQ ID NO: 10, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 10, or a fragment or variant thereof;
-this element of the S5UTR derived from a NOSIP gene comprises or consists of a DNA sequence according to SEQ ID NO: 11, or a DNA sequence having, in increasing order of preference, at least 50%, 60% , 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 11, or a fragment or variant thereof ; or an RNA sequence according to SEQ ID NO: 12, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 12, or a fragment or variant thereof;
-this SUTR element derived from an RPL31 gene comprises or consists of a DNA sequence according to SEQ ID NO: 13, or a DNA sequence having, in increasing order of preference, at least 50%, 60% , 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 13, or a fragment or variant thereof ; an RNA sequence according to SEQ ID NO: 14, or an RNA sequence having, in ascending order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96 %, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 14, or a fragment or variant thereof;
-this SUTR element derived from an SLC7A3 gene comprises or consists of a DNA sequence according to SEQ ID NO: 15, or a DNA sequence having, in increasing order of preference, at least 50%, 60% , 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 15, or a fragment or variant thereof ; or an RNA sequence according to SEQ ID NO: 16, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 16, or a fragment or variant thereof;
-this SUTR element derived from a TUBB4B gene comprises or consists of a DNA sequence according to SEQ ID NO: 17, or a DNA sequence having, in increasing order of preference, at least 50%, 60% , 70%, 80%, 90%, 95%, 96%,
97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 17, or a fragment or variant thereof; or an RNA sequence according to SEQ ID NO: 18, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 18, or a fragment or variant thereof;
-this SUTR element derived from a UBQLN2 gene comprises or consists of a DNA sequence according to SEQ ID NO: 19, or a DNA sequence having, in increasing order of preference, at least 50%, 60% , 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 19, or a fragment or variant thereof ; or an RNA sequence according to SEQ ID NO: 20, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 20, or a fragment or variant thereof;
-this element of the 3UTR derived from a PSMB3 gene comprises or consists of a DNA sequence according to SEQ ID NO: 23, or a DNA sequence having, in increasing order of preference, at least 50%, 60% , 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 23, or a fragment or variant thereof ; or an RNA sequence according to SEQ ID NO: 24, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 24, or a fragment or variant thereof;
-this element of 3UTR derived from a CASP1 gene comprises or consists of a DNA sequence according to SEQ ID NO: 25, or a DNA sequence having, in increasing order of preference, at least 50%, 60% , 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 25, or a fragment or variant thereof ; or an RNA sequence according to SEQ ID NO: 26, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 26, or a fragment or variant thereof;
-this element of the 3UTR derived from a COX6B1 gene comprises or consists of a DNA sequence according to SEQ ID NO: 27, or a DNA sequence having, in increasing order of preference, at least 50%, 60% , 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 27, or a fragment or variant thereof ; or an RNA sequence according to SEQ ID NO: 28, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 28, or a fragment or variant thereof;
- said 3'UTR element derived from a GNAS gene comprises or consists of a DNA sequence in accordance with SEQ ID NO: 29, or a DNA sequence having, in increasing order of preference, at least 50 %, 60%, 70%, 80%, 90%, 95%, 96%,
97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 29, or a fragment or variant thereof; or an RNA sequence according to SEQ ID NO: 30, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 30, or a fragment or variant thereof;
-this element of the 3UTR derived from an NDUFA1 gene comprises or consists of a DNA sequence according to SEQ ID NO: 31, or a DNA sequence having, in increasing order of preference, at least 50%, 60% , 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 31, or a fragment or variant thereof ; or an RNA sequence according to SEQ ID NO: 32, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 32, or a fragment or variant thereof; and / or
-this element of the 3'UTR derived from an RPS9 gene comprises or consists of a DNA sequence according to SEQ ID NO: 33, or a DNA sequence having, in increasing order of preference, at least 50 %, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 33, or a fragment or variant thereof; or an RNA sequence according to SEQ ID NO: 34, or an RNA sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity to the nucleic acid sequence according to SEQ ID NO: 34, or a fragment or variant thereof.
[10]
Artificial nucleic acid molecule according to any one of claims 1 to 9, characterized in that said coding region is located between said 5 'UTR and said 3' UTR, preferably downstream of said 5 'UTR and upstream of said 3 'RTU.
[11]
Artificial nucleic acid molecule according to any one of claims 1 to 10, characterized in that at least one coding region encodes at least one (poly) peptide or protein of interest optionally selected from a (poly) peptide or antigenic protein, (poly) jpeptide or allergenic protein, a (poly) peptide or therapeutic protein, an antibody or fragment, variant or derivative of said (poly) peptide or protein of interest.
[12]
12. Artificial nucleic acid molecule according to claim 11, characterized by the fact that said at least one (poly) peptide or antigenic protein is selected from a tumor antigen, a pathogenic antigen, an autoantigen, an alloantigen or an allergenic antigen .
[13]
13. Artificial nucleic acid molecule according to claim 12, characterized by the fact that said at least one pathogenic antigen is selected from a bacterial, viral, fungal or protozoan antigen.
[14]
14. Artificial nucleic acid molecule according to claim 11, characterized in that said therapeutic (poly) peptide or protein is selected from a therapeutic (poly) peptide or protein that replaces a missing, deficient or mutated protein ; - a therapeutic (poly) peptide or protein beneficial for the treatment of inherited or acquired diseases, infectious diseases or neoplasms (for example, cancer or tumor diseases); - an adjuvant or immunostimulant (poly) peptide or therapeutic protein; - a therapeutic antibody; - a peptide hormone; - a gene editing agent; - an immune checkpoint inhibitor; - a T cell receptor; - an enzyme; and / or - a variant, fragment or derivative of any of said therapeutic (poly) peptides or proteins.
[15]
15. Artificial nucleic acid molecule according to any one of claims 10 to 14, characterized in that it dictates at least one coding region still encodes (a) at least one effector domain; (b) at least one peptide or protein marker; (c) at least one location signal or sequence; (d) at least one nuclear location signal (NLS); (e) at least one signal peptide; and / or (f) at least one peptide linker; (g) a signal secreting peptide (SSP), (h) a multimerization element including dimerization, trimerization, tetramerization or oligomerization elements; (1) a virus-like particle-forming element (VLP); () a transmembrane element; (k) a targeting element for dendritic cells; (1) an immunological adjuvant element;
(m) an element that promotes the presentation of the antigen; (n) a 2A peptide; (o) an element that prolongs the protein's half-life; and / or (p) an element for post-translational modification (for example, glycosylation).
wherein the artificial nucleic acid molecule optionally further comprises at least one internal ribosomal entry site (IRES) and / or at least one miRNA binding site.
[16]
16. Artificial nucleic acid molecule according to any one of claims 1 to 15, characterized in that it dictates at least one coding region encoding one (polypeptide or protein that comprises or consists of an amino acid sequence of according to any of SEQ ID NOs: 41-45, or an amino acid sequence having, in increasing order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97 %, 97%, 98% or 99% sequence identity to the amino acid sequence according to any of SEQ ID NOs: 42-45, or a variant or fragment of any of those sequences.
[17]
17. Artificial nucleic acid molecule according to any one of claims 1 to 15, characterized in that the at least one coding region of said artificial nucleic acid molecule comprises or consists of a nucleic acid sequence according to any one of SEQ ID NOs: 46-49; or a nucleic acid sequence having, in ascending order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% sequence with any of said nucleic acid sequences.
[18]
18. Artificial nucleic acid molecule according to any one of claims 1 to 16, characterized in that said artificial nucleic acid molecule comprises or consists of a nucleic acid sequence according to any of SEQ ID NOs: 50- 368, or a nucleic acid sequence having, in ascending order of preference, at least 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identity sequence with any of said nucleic acid sequences.
[19]
19. Artificial nucleic acid molecule according to any one of claims 1 to 17, characterized in that said artificial nucleic acid molecule is an RNA.
[20]
20. RNA according to claim 19, characterized by the fact that the RNA is mono-, bi- or multicistronic.
[21]
21. RNA according to claim 19 or 20, characterized by the fact that the RNA is an mRNA, a viral RNA, a self-replicating RNA or a replicon RNA.
[22]
22. Artificial nucleic acid, preferably RNA, according to any one of claims 1 to 21, characterized in that said artificial nucleic acid is a modified nucleic acid, preferably a stabilized nucleic acid, or in which the nucleic acid The artificial one comprises at least one modified or unnatural nucleotide, modification of the main chain, modification of the sugar or modification of the base.
[23]
23. Artificial nucleic acid, preferably RNA, according to any one of claims 1 to 22, characterized in that the G / C content of at least one coding region of the artificial nucleic acid is increased compared to G / C content of the corresponding coding sequence of the corresponding wild-type artificial nucleic acid and / or wherein the C content of at least one coding region of the artificial nucleic acid is increased compared to the C content of the sequence corresponding coding of the corresponding wild-type artificial nucleic acid and / or where the codons in at least one coding region of the artificial nucleic acid are adapted to the use of human codons, where the codon adaptation index (CAI) is preferably increased or maximized in at least one coding sequence for the artificial nucleic acid, - where the amino acid sequence encoded by the artificial nucleic acid is preferably not nently being modified in comparison with the amino acid sequence encoded by the corresponding wild-type artificial nucleic acid.
[24]
24. Artificial nucleic acid, preferably RNA, according to any one of claims 1 to 23, characterized in that it comprises a 5'-CAP structure, preferably m7GpppN or Cap1.
[25]
25. Artificial nucleic acid, preferably RNA, according to any one of claims 1 to 24, characterized in that it comprises at least one pendulum pendant of histone.
[26]
26. Artificial nucleic acid, preferably RNA, according to claim 25, characterized in that the at least one pendulum pendant of histone comprises a nucleic acid sequence according to the following formulas (1) or (Il): Formula (1) (pendulum loop sequence without elements bordering the pendulum): [No-2GN3-5] [No-a4 (U / T) No-a] [N3-5CNo-2] Mo Co] 7] pendulum pendulum loop 2 Formula (Il) (pendulum loop sequence with elements bordering the pendulum): Ni1-6 [No-2GN3-5] [No-4 (U / T) No-4] [N3-5CNo-2] Ni- 6 Co AA NO a Sm AA pendulum element 1 pendulum loop 2 border element of the pendulum border 2. pendulum 1 where:
border elements of pendulum 1 or pendulum 2 N1-6 is a consecutive sequence from 1 to 6, preferably from 2 to 6, more preferably from 2 to 5, even more preferably from 3 to 5, more preferably from 4 to 5 or 5 N, wherein each N is independently of another selected from a nucleotide selected from A, U, T, GeC, or its nucleotide analog;
pendululum1 [No-2GN3-s]
it is reverse complementary or partially reverse complementary with the pendulum element2, and is a consecutive sequence between 5 to 7 nucleotides;
where No.2 is a consecutive sequence from 0 to 2, preferably from 0 to 1, more preferably from 1 N, where each N is independent of another selected from a nucleotide selected from A, U, T, Ge C or its nucleotide analog;
where N3.5 is a consecutive sequence from 3 to 5, preferably from 4 to 5, more preferably from 4 N, where each N is independent of another selected from a nucleotide selected from A, U, T, Ge C or its nucleotide analog, and where G is guanosine or its analog and can be optionally substituted by a cytidine or its analogue, provided that its complementary nucleotide cytidine in the pendulum is replaced by guanosine;
loop string [No-4 (U / T) No-1]
it is located between the pendulum and pendulum elements2 and is a consecutive sequence of 3 to 5 nucleotides, more preferably 4 nucleotides;
where each No. is independent of another consecutive sequence from 0 to 4, preferably from 1 to 3, more preferably from 1 to 2 N, where each N is independently from another selected from a nucleotide selected from A, U, T , G and C or its nucleotide analog; and wherein U / T represents uridine or optionally thymidine;
pendulum2 [N3-5CNo.2]
it is reverse complementary or partially reverse complementary with the pendulum element1 and is a consecutive sequence between 5 to 7 nucleotides;
where N3.5 is a consecutive sequence from 3 to 5, preferably from 4 to 5, more preferably from 4 N, where each N is independent of another selected from a nucleotide selected from A, U, T, Ge C or its nucleotide analog;
where No.2 is a consecutive sequence from 0 to 2, preferably from 0 to 1, more preferably from 1 N, where each N is independent of another selected from a nucleotide selected from A, U, T, G or C or its nucleotide analog; and where C is cytidine or its analogue, and can optionally be replaced by a guanosine or its analog, provided that its complementary guanosine nucleoside in the pendulum is replaced by cytidine; in which pendulum 1 and pendulum are capable of base pairing with each other forming a reverse complementary sequence, where base pairing can occur between pendulum and pellet2, or forming a partially re- complementary sequence
versa, in which an incomplete base pairing can occur between pendulum and pendulum.
[27]
27. Artificial nucleic acid, preferably RNA, according to claim 25 or 26, characterized in that at least one pendulum pendant of histone comprises a nucleic acid sequence according to the following formulas (la) or ( lla): formula (la) (pendulum loop sequence without elements bordering the pendulum): [No-1GN3-5] [N1-3 (U / T) No-2] [N3-5CNo-1] Ss mm— AA pendulum 1 loop pendulum 2 formula (lla) (pendulum loop sequence with elements bordering the pendulum): N2-5 [No-1GN3-5] [N1-3 (U / T) No-2] [N3-5CNo-1 ] N2-5 AA É] The element - pendulum 1 pendulum 2 - element bordering the loop bordering the pendulum 1 pendulum 2
[28]
28. Artificial nucleic acid, preferably RNA, according to any one of claims 1 to 27, characterized in that it optionally comprises a poly (A) sequence, preferably comprising 10 to 200, 10 to 100, 40 to 80 or 50 to 70 adenosine nucleotides.
[29]
29. Artificial nucleic acid, preferably RNA, according to any one of claims 1 to 28, characterized in that it optionally comprises a poly (C) sequence, preferably comprising 10 to 200, 10 to 100, 20 to 70, 20 to 60 or 10 to 40 cytosine nucleotides.
[30]
30. Artificial nucleic acid, preferably RNA, according to any one of claims 1 to 29, characterized in that it comprises, preferably in the direction of 5 'to 3', the following elements: a) a 5-CAP structure , preferably m / GpppN or Cap1; b) a 5-UTR element, which comprises or consists of a nucleic acid sequence, which is derived from a 5-UTR according to any one of claims 1 to 9, preferably comprising a nucleic acid sequence corresponding to the sequence nucleic acid according to SEQ ID NO: 1-22 or its homolog, fragment or variant; c) at least one coding sequence according to any one of claims 10 to 18; d) a 3'-UTR element, which comprises or consists of a nucleic acid sequence, which is derived from a 3-UTR according to any one of claims 1 to 9, preferably comprising a nucleic acid sequence corresponding to the sequence of nucleic acid according to SEQ ID NO: 23-36, or its homolog, fragment or variant, e) optionally, a poly (A) tail, preferably consisting of 10 to 1000, 10 to 500, 10 to 300 , 10 to 200, 10 to 100, 40 to 80 or 50 to 70 adenosine nucleotides, f) optionally, a poly (C) tail, preferably consisting of 10 to 200, 10 to 100, 20 to 70, 20 to 60 or 10 to 40 cytosine nucleotides, eg) optionally, a histone penducular loop.
[31]
31. Composition, characterized by the fact that it comprises at least one or a plurality of artificial nucleic acid molecules, preferably RNA (s), according to any one of claims 1 to 30, and a vehicle and / or pharmaceutically excipient
acceptable.
[32]
32. Composition according to claim 31, characterized in that at least two of said plurality of artificial nucleic acid molecules each (a) comprise the same or a different combination of RTU elements according to any one of claims 1 to 9 and / or (b) encodes a different peptide or protein, optionally selected from a peptide or protein according to any one of claims 11 to 17.
[33]
33. Composition according to claim 31 or 32, characterized by the fact that it is for use as a medicine, optionally for use as a vaccine.
[34]
34. (Pharmaceutical) composition according to claim 33, which preferably comprises at least one artificial nucleic acid molecule comprising a combination of RTU as defined in claim 6, characterized in that said (pharmaceutical) composition and / or said artificial nucleic acid molecule are adapted for the targeted release to the liver.
[35]
35. (Pharmaceutical) composition according to claim 33, preferably comprising at least one artificial nucleic acid molecule comprising a combination of RTU as defined in claim 7, characterized in that said (pharmaceutical) composition and / or said artificial nucleic acid molecule are adapted for subcutaneous, intracutaneous, intradermal, topical or transdermal administration.
[36]
36. (Pharmaceutical) composition according to claim 33, preferably comprising at least one artificial nucleic acid molecule comprising a combination of RTU as defined in claim 8, characterized in that said (pharmaceutical) composition and / or said artificial nucleic acid molecule are adapted for intramuscular administration.
[37]
37. Composition (pharmaceutical) or vaccine according to any one of claims 31 to 36, characterized in that the artificial nucleic acid molecule, preferably RNA, is complexed with one or more cationic or polycationic compounds, preferably with cationic polymers or polycationic, cationic or polycationic peptides or proteins, for example, protamine, cationic or polycationic polysaccharides and / or cationic or polycationic lipids or polymeric vehicles.
[38]
38. Composition (pharmaceutical) or vaccine according to claim 37, characterized by the fact that the N / P ratio of the artificial nucleic acid molecule, preferably RNA, for one or more cationic or polycationic peptides or proteins is in the range about 0.1 to 10, including a range of about 0.3 to 4, about 0.5 to 2, about 0.7 to 2 and about 0.7 to 1.5.
[39]
39. Composition (pharmaceutical) or vaccine according to any one of claims 31 to 38, characterized by the fact that the artificial nucleic acid molecule, preferably RNA, is complexed with one or more lipids, thus forming lipid nanoparticles, lipoplexes and / or preferably liposomes.
[40]
40. Composition (pharmaceutical) or vaccine according to any one of claims 31 to 39, characterized in that it still comprises at least one additional active agent and / or at least one adjuvant.
[41]
41. Composition (pharmaceutical) or vaccine according to any one of claims 31 to 40, characterized in that it still comprises a non-coding RNA selected from the group consisting of small interfering RNA (siRNA), antisense RNA (asRNA ), Circular RNA (circRNA), ribozymes, aptamers, "riboshemages", immunostimulating RNA (iSsRNA), transfer RNA (tRNA), ribosomal RNA (r> RNA), small nuclear RNA (snRNA), nucleic RNA
small olar (snoRNA), microRNA (miRNA) and Piwi interaction RNA (piRNA).
[42]
42. Composition (pharmaceutical) or vaccine according to claim 41, characterized by the fact that the immunostimulatory RNA (isSRNA) comprises at least one RNA sequence according to formula (Ill) (GXmGn), formula (IV ) (CIXmCrn), formula (V) (NuGIXmGnNy) a and / or formula (VI) (NuCiXmCrNy) a.
[43]
43. Composition (pharmaceutical) or vaccine according to claim 41 or 42, characterized in that it comprises a polymeric vehicle loading complex, formed by a polymeric vehicle, preferably comprising cationic peptides cross-linked with disulfide, preferably Cys-Arg12 and / or Cys-Arg12-Cys, and an isRNA.
[44]
44. Kit, preferably kit of parts, characterized by the fact that it comprises the artificial nucleic acid molecule, preferably RNA, as defined in any one of claims 1 to 30 or the (pharmaceutical) composition or vaccine as defined in any one of claims 31 to 43, and optionally a liquid carrier and / or optionally technical instructions with information on the administration and dosage of the artificial nucleic acid molecule or composition (pharmaceutical) or vaccine.
[45]
45. Kit according to claim 44, characterized by the fact that the kit contains as a part the Ringer-Lactate solution.
[46]
46. Artificial nucleic acid molecule, preferably RNA, according to any one of claims 1 to 30, the (pharmaceutical) composition or vaccine according to any one of claims 31 to 43, or kit according to claim 44 or 45, characterized by the fact that it is for use as a medicine.
[47]
47. Artificial nucleic acid molecule, preferably
RNA according to any one of claims 1 to 30, composition (pharmaceutical) or vaccine according to any one of claims 31 to 43, or kit according to claim 44 or 45, characterized by the fact that it is for use in the treatment of genetic diseases, cancer, infectious diseases, inflammatory diseases, (auto) immune diseases, allergies and / or for use in gene therapy and / or immunomodulation.
[48]
48. Artificial nucleic acid molecule, preferably RNA, composition (pharmaceutical) or vaccine or kit for use according to claim 47, characterized by the fact that said use comprises (a) administering to a patient with his said need artificial nucleic acid molecule, preferably RNA, said composition (pharmaceutical) or said kit.
[49]
49. Artificial nucleic acid molecule, preferably RNA, according to any one of claims 6 to 30, composition (pharmaceutical) or vaccine according to any one of claims 31 to 43, or kit according to claim 44 or 45, said composition (pharmaceutical) or kit comprising at least one artificial nucleic acid molecule according to any one of claims 6 to 30, characterized in that it is for use in a method of increasing the expression efficiency of said artificial nucleic acid molecule in liver tissue, liver cells or liver cell lines.
[50]
50. Artificial nucleic acid molecule, preferably RNA, according to any one of claims 7 to 30, composition (pharmaceutical) or vaccine according to any one of claims 31 to 43, or kit according to claim 44 or 45, said composition (pharmaceutical) or kit comprising at least one artificial nucleic acid molecule according to any one of claims 7 to 30, characterized in that it is for use in a method of increasing the expression efficiency of said artificial nucleic acid molecule in skin tissue, skin cells or skin cell lines.
[51]
51. Artificial nucleic acid molecule, preferably RNA, according to any one of claims 8 to 30, composition (pharmaceutical) or vaccine according to any one of claims 31 to 43, or kit according to claim 44 or 45, said composition (pharmaceutical) or kit comprising at least one artificial nucleic acid molecule according to any one of claims 8 to 30, characterized in that it is for use in a method of increasing the expression efficiency of said artificial nucleic acid molecule in muscle tissue, muscle cells or muscle cell lines.
[52]
52. Method of treatment or prevention of a disorder optionally selected from genetic diseases, cancer, infectious diseases, inflammatory diseases, (auto) immune diseases, allergies and / or for use in gene therapy and / or immunomodulation, characterized by the fact that said method comprises administering to an individual with his need an effective amount of the artificial nucleic acid molecule, preferably RNA, as defined in any one of claims 1 to 30, the composition (pharmaceutical) or vaccine according to with any one of claims 31 to 43, or the kit according to claim 44 or 45.
[53]
53. Method for increasing the expression efficiency of an artificial nucleic acid molecule, preferably RNA, comprising at least one coding region that encodes a protein or peptide preferably according to any of claims 11 to 16, said method characterized by the fact that it comprises (a) the association of said coding region with at least one element of the 5 'RTU derived from a 5' RTU of a gene selected from the group consisting of HSD17B4, ASAH1, ATP5A1, MP68, NDUFA4, NOSIP, RPL31, SLC7A3, TUBB4B and UBOQLN 2, or a corresponding RNA sequence, its homolog, fragment or variant; (b) the association of said coding region with at least one element of the 3 'UTR derived from a 3' UTR of a gene selected from the group consisting of PSMB3, CASP1, COXG6B1, GNAS, NDUFA1 and RPS9, or a corresponding RNA sequence, its homolog, fragment or variant; and (c) obtaining an artificial nucleic acid molecule, preferably RNA, as defined in any one of claims 1 to 30.
[54]
54. Method for identifying a combination of 5 'RTU and 3' RTU capable of increasing the efficiency of expression in a desired tissue or in a cell derived from the desired tissue, characterized by the fact that it comprises: a) generating a library of artificial nucleic acid molecules ("test constructs"), each comprising a "reporter ORF" encoding a detectable reporter polynucleotide, preferably luciferase or selected eGFP, operably linked to one of the 5 'RTUs and / or one of the 3 'RTUs, according to claim 3; b) providing an artificial nucleic acid molecule comprising said "reporter ORF" operably linked to the 5 'and 3' reference RTUs, preferably RPL32 and ALB7 as a "reference construction"; c) introducing said test constructs and said reference constructions into the desired tissue or cell under suitable conditions, allowing their expression;
d) detecting and quantifying the expression of said polypeptide from the "reporter ORF" of the test constructs and the reference construct;
e) comparing the polypeptide expression of the test constructs and reference constructs;
wherein test constructs characterized by increased polypeptide expression compared to the reference construct are identified as being able to increase the efficiency of expression in the desired tissue or cell.

类似技术:

---

公开号 | 公开日 | 专利标题

---

KR20200071081A|2020-06-18|New artificial nucleic acid molecule

---

US20210046179A1|2021-02-18|COMPOSITION COMPRISING A COMPLEXED |RNA AND A NAKED mRNA FOR PROVIDING OR ENHANCING AN IMMUNOSTIMULATORY RESPONSE IN A MAMMAL AND USES THEREOF

---

US9616084B2|2017-04-11|Mannose-containing solution for lyophilization, transfection and/or injection of nucleic acids

---

KR101513254B1|2015-04-28|Complexes of rna and cationic peptides for transfection and for immunostimulation

---

WO2010088927A1|2010-08-12|Use of pei for the improvement of endosomal release and expression of transfected nucleic acids, complexed with cationic or polycationic compounds

---

WO2011069587A1|2011-06-16|Lyophilization of nucleic acids in lactate-containing solutions

---

EP2510100B1|2017-10-11|Mannose-containing solution for lyophilization, transfection and/or injection of nucleic acids

同族专利:

---

公开号 | 公开日

---

AU2018351481A1|2020-03-12|

---

KR20200071081A|2020-06-18|

---

SG11202002186VA|2020-05-28|

---

RU2020115287A|2021-11-19|

---

CA3073634A1|2019-04-25|

---

CN111630173A|2020-09-04|

---

IL272850D0|2020-04-30|

---

EP3697912A1|2020-08-26|

---

WO2019077001A1|2019-04-25|

---

JP2021501572A|2021-01-21|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US4816567A|1983-04-08|1989-03-28|Genentech, Inc.|Recombinant immunoglobin preparations|

---

US7112329B1|1996-06-14|2006-09-26|Meiji Milk Products Co. Ltd.|T cell epitope peptide|

---

US6320017B1|1997-12-23|2001-11-20|Inex Pharmaceuticals Corp.|Polyamide oligomers|

---

AU6620300A|1999-08-03|2001-02-19|Ohio State University, The|Polypeptides and polynucleotides for enhancing immune reactivity to her-2 protein|

---

US20030138769A1|2000-08-16|2003-07-24|Birkett Ashley J.|Immunogenic HBc chimer particles having enhanced stability|

---

DE50214379D1|2001-06-05|2010-05-27|Curevac Gmbh|Stabilized mRNA with elevated G / C content for gene therapy|

---

DE10162480A1|2001-12-19|2003-08-07|Ingmar Hoerr|The application of mRNA for use as a therapeutic agent against tumor diseases|

---

JP2010507361A|2006-07-31|2010-03-11|キュアバックゲーエムベーハー|Specifically, a nucleic acid represented by the general formula : GlXmGn or the general formula : ClXmCn as an immunostimulant / adjuvant|

---

US9249202B2|2006-08-11|2016-02-02|Life Sciences Research Partners Vzw|Immunogenic peptides and their use in immune disorders|

---

WO2009030254A1|2007-09-04|2009-03-12|Curevac Gmbh|Complexes of rna and cationic peptides for transfection and for immunostimulation|

---

WO2009046739A1|2007-10-09|2009-04-16|Curevac Gmbh|Composition for treating prostate cancer |

---

WO2009046738A1|2007-10-09|2009-04-16|Curevac Gmbh|Composition for treating lung cancer, particularly of non-small lung cancers |

---

JP5749494B2|2008-01-02|2015-07-15|テクミラ ファーマシューティカルズ コーポレイション|Improved compositions and methods for delivery of nucleic acids|

---

PT2176408E|2008-01-31|2015-04-23|Curevac Gmbh|Nucleic acids comprising formula a and derivatives thereof as an immunostimulating agents /adjuvants|

---

US8058069B2|2008-04-15|2011-11-15|Protiva Biotherapeutics, Inc.|Lipid formulations for nucleic acid delivery|

---

WO2010037408A1|2008-09-30|2010-04-08|Curevac Gmbh|Composition comprising a complexed rna and a naked mrna for providing or enhancing an immunostimulatory response in a mammal and uses thereof|

---

EP2350043B9|2008-10-09|2014-08-20|TEKMIRA Pharmaceuticals Corporation|Improved amino lipids and methods for the delivery of nucleic acids|

---

WO2010048536A2|2008-10-23|2010-04-29|Alnylam Pharmaceuticals, Inc.|Processes for preparing lipids|

---

WO2010053572A2|2008-11-07|2010-05-14|Massachusetts Institute Of Technology|Aminoalcohol lipidoids and uses thereof|

---

WO2010054401A1|2008-11-10|2010-05-14|Alnylam Pharmaceuticals, Inc.|Novel lipids and compositions for the delivery of therapeutics|

---

WO2010087791A1|2009-01-27|2010-08-05|Utc Power Corporation|Distributively cooled, integrated water-gas shift reactor and vaporizer|

---

CA2751342C|2009-01-29|2019-05-07|Alnylam Pharmaceuticals, Inc.|Lipid formulations comprising cationic lipid and a targeting lipid comprising n-acetyl galactosamine for delivery of nucleic acid|

---

CA2760776C|2009-05-05|2019-07-09|Alnylam Pharmaceuticals, Inc.|Lipid compositions for the delivery of therapeutic agents|

---

LT3431076T|2009-06-10|2021-10-25|Arbutus Biopharma Corporation|Improved lipid formulation|

---

US20110053829A1|2009-09-03|2011-03-03|Curevac Gmbh|Disulfide-linked polyethyleneglycol/peptide conjugates for the transfection of nucleic acids|

---

CN104959052B|2010-04-09|2018-07-13|帕西拉制药有限公司|The method for synthesizing membrane vesicle for preparing major diameter|

---

KR101967411B1|2010-06-03|2019-04-10|알닐람 파마슈티칼스 인코포레이티드|Biodegradable lipids for the delivery of active agents|

---

NZ606591A|2010-07-06|2015-02-27|Novartis Ag|Cationic oil-in-water emulsions|

---

CA2804396C|2010-07-06|2021-06-29|Novartis Ag|Liposomes with lipids having an advantageous pka-value for rna delivery|

---

DK2449113T3|2010-07-30|2016-01-11|Curevac Ag|Complex formation of nucleic acids with the disulfide cross-linked cationic components for transfection and immunostimulation|

---

WO2012019630A1|2010-08-13|2012-02-16|Curevac Gmbh|Nucleic acid comprising or coding for a histone stem-loop and a poly sequence or a polyadenylation signal for increasing the expression of an encoded protein|

---

JP5911870B2|2010-08-31|2016-04-27|ノバルティス アーゲー|PEGylated liposomes for delivery of RNA encoding immunogens|

---

EP2611420B1|2010-08-31|2019-03-27|GlaxoSmithKline Biologicals SA|Lipids suitable for liposomal delivery of protein-coding rna|

---

MX341989B|2010-08-31|2016-09-09|Novartis Ag |Small liposomes for delivery of immunogen-encoding rna.|

---

WO2012089225A1|2010-12-29|2012-07-05|Curevac Gmbh|Combination of vaccination and inhibition of mhc class i restricted antigen presentation|

---

WO2012113413A1|2011-02-21|2012-08-30|Curevac Gmbh|Vaccine composition comprising complexed immunostimulatory nucleic acids and antigens packaged with disulfide-linked polyethyleneglycol/peptide conjugates|

---

MX350764B|2011-07-06|2017-09-18|Novartis Ag|Liposomes having useful n:p ratio for delivery of rna molecules.|

---

WO2013120500A1|2012-02-15|2013-08-22|Curevac Gmbh|Nucleic acid comprising or coding for a histone stem-loop and a poly sequence or a polyadenylation signal for increasing the expression of an encoded tumour antigen|

---

SG10201607968WA|2012-03-27|2016-12-29|Curevac Ag|Artificial nucleic acid molecules for improved protein or peptide expression|

---

MX358706B|2012-03-27|2018-08-31|Curevac Ag|Artificial nucleic acid molecules comprising a 5'top utr.|

---

GB2502127A|2012-05-17|2013-11-20|Kymab Ltd|Multivalent antibodies and in vivo methods for their production|

---

CA2897858A1|2013-02-22|2014-08-28|Curevac Gmbh|Combination of vaccination and inhibition of the pd-1 pathway|

---

BR112016000889A2|2013-08-21|2017-12-12|Curevac Ag|composition and vaccine for prostate cancer treatment|

---

CN105517569A|2013-08-21|2016-04-20|库瑞瓦格股份公司|Rabies vaccine|

---

EA037217B1|2013-08-21|2021-02-20|Куревак Аг|Composition and vaccine for treating lung cancer|

---

RU2723328C2|2013-08-21|2020-06-09|Куревак Аг|Vaccine against respiratory syncytial virus |

---

JP6704850B2|2013-12-30|2020-06-03|キュアバック アーゲー|Artificial nucleic acid molecule|

---

EP3116535B1|2014-03-12|2019-08-07|CureVac AG|Combination of vaccination and ox40 agonists|

---

US10369216B2|2014-04-01|2019-08-06|Curevac Ag|Polymeric carrier cargo complex for use as an immunostimulating agent or as an adjuvant|

---

WO2016097065A1|2014-12-16|2016-06-23|Curevac Ag|Ebolavirus and marburgvirus vaccines|

---

CN107124889A|2014-12-30|2017-09-01|库瑞瓦格股份公司|Artificial nucleic acid molecule|

---

ES2746340T3|2015-04-22|2020-03-05|Curevac Ag|Composition containing RNA for the treatment of tumor diseases|

---

EP3317424A1|2015-07-01|2018-05-09|CureVac AG|Method for analysis of an rna molecule|

---

US20180237786A1|2015-08-28|2018-08-23|Curevac Ag|Artificial nucleic acid molecules|

---

US20190160164A1|2015-11-09|2019-05-30|Curevac Ag|Rotavirus vaccines|

---

EP3374504A2|2015-11-09|2018-09-19|CureVac AG|Optimized nucleic acid molecules|

---

KR20180107109A|2015-12-22|2018-10-01|큐어백 아게|Method for producing RNA molecular composition|

---

SG11201806340YA|2016-02-17|2018-09-27|Curevac Ag|Zika virus vaccine|

---

US20200149026A1|2016-12-08|2020-05-14|Curevac Ag|Rnas for wound healing|

---

WO2018172556A1|2017-03-24|2018-09-27|Curevac Ag|Nucleic acids encoding crispr-associated proteins and uses thereof|AU2019254591A1|2018-04-17|2020-09-10|Curevac Ag|Novel RSV RNA molecules and compositions for vaccination|

---

WO2020254535A1|2019-06-18|2020-12-24|Curevac Ag|Rotavirus mrna vaccine|

---

WO2021028439A1|2019-08-14|2021-02-18|Curevac Ag|Rna combinations and compositions with decreased immunostimulatory properties|

---

WO2021038089A1|2019-08-29|2021-03-04|Universität Zürich|Minimal messenger rnas and uses thereof|

---

CN112759652A|2019-11-01|2021-05-07|北京华夏清医治疗科技有限公司|Chimeric antigen receptor and application thereof|

---

WO2021092440A1|2019-11-07|2021-05-14|Icahn School Of Medicine At Mount Sinai|Synthetic modified rna and uses thereof|

---

WO2021123332A1|2019-12-20|2021-06-24|Curevac Ag|Lipid nanoparticles for delivery of nucleic acids|

---

WO2021156267A1|2020-02-04|2021-08-12|Curevac Ag|Coronavirus vaccine|

---

US11241493B2|2020-02-04|2022-02-08|Curevac Ag|Coronavirus vaccine|

---

WO2021202772A1|2020-04-01|2021-10-07|University Of Florida Research Foundation, Incorporated|Multilamellar rna nanoparticle vaccine against sars-cov-2|

---

WO2021239880A1|2020-05-29|2021-12-02|Curevac Ag|Nucleic acid based combination vaccines|

---

WO2022023559A1|2020-07-31|2022-02-03|Curevac Ag|Nucleic acid encoded antibody mixtures|

---

WO2022028559A1|2020-08-07|2022-02-10|The Hong Kong University Of Science And Technology|Compositions and methods for increasing protein expression|

---

WO2022043551A2|2020-08-31|2022-03-03|Curevac Ag|Multivalent nucleic acid based coronavirus vaccines|

---

CN113341152A|2021-04-27|2021-09-03|华南农业大学|Application of RPS9 protein in prediction of good response of crab eating monkey to superovulation|

法律状态:
2021-11-23| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

EP2017076775|2017-10-19|

---

EPPCT/EP2017/076741|2017-10-19|

---

EP2017076741|2017-10-19|

---

EPPCT/EP2017/076775|2017-10-19|

---

EPPCT/EP2018/057552|2018-03-23|

---

PCT/EP2018/057552|WO2018172556A1|2017-03-24|2018-03-23|Nucleic acids encoding crispr-associated proteins and uses thereof|

---

EP2018076185|2018-09-26|

---

EPPCT/EP2018/076185|2018-09-26|

---

PCT/EP2018/078453|WO2019077001A1|2017-10-19|2018-10-17|Novel artificial nucleic acid molecules|

---